PCR primer design
|
The software listed in this site is for non-commercial use only. It is provided as is, and it comes with no guaranttee. Neither current and former members of Glazebrook and Katagiri Labs nor Univ. of Minnesota are responsible for any damage caused by use of the software.
Perl script for designing PCR primer sets for genotyping of Arabidopsis T-DNA insertion lines can be downloaded here ("t_primer_design11e_1na.pl").
The script "t_primer_design11e_1na.pl" needs two types of input files:
(1) T-DNA line information, which can be downloaded from SIGnAL, downloading site (http://signal.salk.edu/data/). It should be in the tab-delimited text format like this example. The name of this file is hard-coded in line 21 of the script. Change this name as needed.
(2) Arabidopsis thaliana Col-0 chromosome sequences. The ver. 5 release of the Arabidopsis genome sequence from TAIR site (ftp://ftp.arabidopsis.org/home/tair/Genes/TIGR5_genome_release/) was used. You need the genome sequence (each chromosome sequence in a separate file) corresponds to the sequence information in input file (1). According to the name of the file, the file name in line 94 of the script needs to be changed.
This script was particularly written for "SALK_" lines, as the T-DNA left border primer used was 'GGAACAACACTCAACCCTATCTCG' (which we named LBe primer). The left border primer sequence needs to be specified in line 14 of the script. We used 'TTCATAACCAATCTCGATACAC' (LB3A) for "SAIL_" lines, 'TCCGCAATGTGTTATTAAGTTGTC' (p745A) for "WISC_" lines, and 'ATATTGACCATCATACTCATTGC' (LBx) for "GABI_" lines.
The output file has two primers RP (1st primer) and LP (2nd primer) for each line. If you use RP and the left border (LB) primer, the product from the insertion can be amplified. If you use RP and LP, the genomic sequence without the insertion can be amplified. So, a homozygous mutant can be identified by presence of a product with RP and LB primers and absence of a product with RP and LP primers. The conditions for the primer design (such as the range of PCR products) is listed between lines 9-18 as "paramters" in the script.
When there are many lines, the script takes time. Alternatively you can download the primer sequences alreadty designed for these lines here.
Here are parsers for the primer sequence files. Separate parsers were made for different kiinds of lines (SALK, SAIL, WISC, and GABI). Sorry, but I didn't make a parser for all combined. Change the primer sequence file names (line 6 of the scripts) as needed. You feed a text file with insertion line names (one line name per line; include "SALK_" and such) to get the primer sequences back. The output file is a tab-delimited text. The output table has insertion line name, chromosome and chromosomal position of the insertion, flag (if the flag is '1', the primer set may not be good), RP sequence and length, LP sequence and length, estimated product size for RP-LP, and estimated product size for RP-LB (ignore the last column).
"salk_primer_parser_e_1na.pl"; SALK_line parser
"sail_primer_parser_3a_1na.pl"; SAIL_line parser
"wisc_primer_parser_745a_1na.pl"; WISC_line parser
"gabi_primer_parser_x_1na.pl"; GABI_line parser
|