This file created on 11/08/11 ====================================================== Strain: VC1705 Species: Caenorhabditis elegans Genotype: ehbp-1(ok2140) V/nT1[qIs51](IV;V). Description: F25B3.1. Homozygous lethal/sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2140 homozygotes (late larval or sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGGCAGCTGACTGATACA. External right primer: AACTTCTCACCCGTTGGATG. Internal left primer: AACCTACCGAGAGCGTGAGA. Internal right primer: GCTTTCCGTGAATTTGGTGT. Internal WT amplicon: 3312 bp. Deletion size: 1369 bp. Deletion left flank: AGGAACATCGAAAATCGAAAAAAAAATTCG. Deletion right flank: TACATAACTGAACATTTCCTACTACCATAT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Lucy Liu Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC1732 Species: Caenorhabditis elegans Genotype: let-526(gk816) I/hT2[bli-4(e937) let-?(q782) qIs48](I;III). Description: C01G8.9. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk816 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. (Note: in this strain hT2[qIs48] occasionally recombines such that the GFP and its associated lethality are lost and the non-GFP hT2 left behind still carries the bli-4 mutation of the original hT2. Such a recombination event results in a viable non-GFP animal that is no longer gk816/hT2[qIs48] but is gk816/hT2.) External left primer: GCCATCACTTTCATCGGATT. External right primer: AATAGACGGCACGTGGAAAC. Internal left primer: ATTCGTTGTTGATAAGCCGC. Internal right primer: ATGACCGATGATGATGACGA. Internal WT amplicon: 1843 bp. Deletion size: 1268 bp. Deletion left flank: AGACATAGACGTCATGCGAAAAATAATATA. Deletion right flank: TCTATATATTCTCCGCGTGGTGGGCTATTT. Insertion Sequence: TATAT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: UV/TMP Outcrossed: x1 Reference: Made by: Jon Taylor Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2216 Species: Caenorhabditis elegans Genotype: K10D2.4(ok2759) III/hT2[bli-4(e937) let-?(q782) qIs48](I;III). Description: K10D2.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2759 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 658 bp. Deletion left flank: TTAAAATCTCAGCGGGAGTTTGATCAAATT. Deletion right flank: CATTGGGAAAGACGAACCGAATAATAGGTA. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Lucy Liu Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2223 Species: Caenorhabditis elegans Genotype: ZC434.7&ZC434.8(ok2797) I/hT2[bli-4(e937) let-?(q782) qIs48](I;III). Description: ZC434.8, ZC434.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2797 homozygotes (grotty sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCATCACATCGACACTTCC. External right primer: AAGGAGCTTCTGACTGCTCG. Internal left primer: GAATCGAGACGAGACGGAAT. Internal right primer: AGAAGCACTTGACAAAGGACG. Internal WT amplicon: 1371 bp. Deletion size: 991 bp. Deletion left flank: AGAAACATTAAACGTTATAAAGTTGAAGTT. Deletion right flank: AAAAAGTAATTACATTTTTCTCTCCCAAAT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Nadereh Rezania Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2225 Species: Caenorhabditis elegans Genotype: npp-6(ok2821) I/hT2[bli-4(e937) let-?(q782) qIs48](I;III). Description: F56A3.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2821 homozygotes (sterile with spiky vulva, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGGCCAATATTCGAGTTTC. External right primer: CGTGTCAGTAGCGTCATCGT. Internal left primer: CATTGCTCAACGCAATCACT. Internal right primer: GCTCGATCGTCTGAAAAACA. Internal WT amplicon: 1360 bp. Deletion size: 549 bp. Deletion left flank: ATGATGAAGAAAGAGGGTGGTTACGGACCA. Deletion right flank: CAATCACTCAAGCTTATTCTCAGGACAACA. Insertion Sequence: TATGGCTATGATGAAATTCGAGAGTGGTTT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Nadereh Rezania Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2229 Species: Caenorhabditis elegans Genotype: pfd-6(ok2785) I/hT2[bli-4(e937) let-?(q782) qIs48](I;III). Description: F21C3.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2785 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAATTTGTGGTTGGGGATT. External right primer: ATTTCAACGCTGCTGGAGAC. Internal left primer: ATGATGGCTGACTTTGAGCA. Internal right primer: TGCAAAGTTGGTTTTCACGA. Internal WT amplicon: 1193 bp. Deletion size: 286 bp. Deletion left flank: GATGTAATTAGCAATGACTTTTAACATAGA. Deletion right flank: TGTCTGAGATGCTGGCTTCCACTCGTTTGC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Nadereh Rezania Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2332 Species: Caenorhabditis elegans Genotype: pat-2(ok2148) III/hT2[bli-4(e937) let-?(q782) qIs48](I;III). Description: F54F2.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2148 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTCATCGTCTTGGATACG. External right primer: AAGTGAAGTTTGTCAGCCCG. Internal left primer: TCGTGTTTTTATTGGAGCCC. Internal right primer: CGACTATGAGATCGTGGCAA. Internal WT amplicon: 3238 bp. Deletion size: 1660 bp. Deletion left flank: CAGTTGTTGGAGATGATCAGTGGGGACGAT. Deletion right flank: TTTTATAATGAGACAAGTTCACAGCCATTT. Insertion Sequence: GTGGAGTGGAGAGATGTGGAGTGGGGAGTGGGGAGTGGGGA. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Lucy Liu Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2382 Species: Caenorhabditis elegans Genotype: ZK930.1(ok3132)/mIn1[mIs14 dpy-10(e128)] II. Description: ZK930.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3132 homozygotes (larval arrest). This strain exhibits a high level of sterility or near-sterility in heterozygotes and mIn1 homozygotes, but populations can be maintained. Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATAGGTGGATGGCTGGAAA. External right primer: CGAAATGTTGGCTCATCTCA. Internal left primer: TCTCCTTGGCTTCTGTGTCC. Internal right primer: GCTCACTTGGCTCTTCGTCT. Internal WT amplicon: 1200 bp. Deletion size: 789 bp. Deletion left flank: TGTCCAACACGGTGCGTTCATAAATTACAA. Deletion right flank: TTGTCCAACATCAGCCCATCGGACGAAACC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Mikhaela Partridge Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2504 Species: Caenorhabditis elegans Genotype: flp-15(gk1186) III. Description: ZK525.1. External left primer: GGCATAGCAGCAGACTAC. External right primer: CCTGAGTGTTGTGATTCC. Internal left primer: TCACACAAACCCGTTACC. Internal right primer: GGTTGCCAAGACCCGAAG. Internal WT amplicon: 2040 bp. Deletion size: 708 bp. Deletion left flank: TTGCCGAAATTGCCGATTTTCATTCAAGGA. Deletion right flank: AAAAAGCAATCAAACCGTTTGAGATATAAA. Insertion Sequence: AAAAAAAA. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: UV/TMP Outcrossed: x0 Reference: Made by: Vancouver KO Group Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2621 Species: Caenorhabditis elegans Genotype: tag-163(ok80) I. Description: M01E11.7. External left primer: GGTTGCTCAGGTTCAAGCTC. External right primer: TGAAATTGTTGGCGTGTGTT. Internal left primer: AACACCTTCCGCGTGTTATC. Internal right primer: CGTCCGTGATTCGAACTCTT. Internal WT amplicon: 2173 bp. Deletion size: 1514 bp. Deletion left flank: TCAAGTGGTACGTGATTGGATTTTGTACTA. Deletion right flank: CCATATGGTTTCCCTAAACTCACCTCATTA. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: Outcrossed: x Reference: Made by: OMRF Knockout Group Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2727 Species: Caenorhabditis elegans Genotype: +/mT1 II; klp-19(ok2481)/mT1[dpy-10(e128)] III. Description: Y43F4B.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2481 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTCCCATGAAGTTTGTCGT. External right primer: ATTGTGCGTGAACTCTGACG. Internal left primer: TTCTCATCGACCCGATTTTC. Internal right primer: TTTGATTTCAAAAGCCTCCG. Internal WT amplicon: 3279 bp. Deletion size: 1984 bp. Deletion left flank: AGACAAAATAGGACAATGGGAAAAACAGAC. Deletion right flank: GGTGTTCATGATTCTTTGGAACAACGCACT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Greta Raymant Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2762 Species: Caenorhabditis elegans Genotype: F28D1.1(ok3338) IV/nT1[qIs51](IV:V). Description: F28D1.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3338 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGCAGCTTGAACGACATGA. External right primer: AACATACTCGTGAATCCGCC. Internal left primer: GAGGAGGATCACTCGCTGAC. Internal right primer: GTCCAATTCCGAGCACATCT. Internal WT amplicon: 1167 bp. Deletion size: 433 bp. Deletion left flank: ACAGCTCGCCTCGAATTTCTTCCCCATCAT. Deletion right flank: CGTGTAAAGAGCCGTATTTGGTGCACAATT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Lucy Liu Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2763 Species: Caenorhabditis elegans Genotype: pqn-47(ok3445)/mIn1[mIs14 dpy-10(e128)] II. Description: F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3445 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCGTAGTTTCGGTTATGCC. External right primer: AGCTTTGCTGGTATTGACGG. Internal left primer: TCAAGGACATAAAGAGCTGACA. Internal right primer: GTCAGCAACAGGCAATCAGA. Internal WT amplicon: 1381 bp. Deletion size: 636 bp. Deletion left flank: GAAGACAAGCGGCCATAATGGAAACCAAGG. Deletion right flank: ACAGGGCTCCTCCATTTCGTTGCCATCCAA. Insertion Sequence: GCTCCTACAC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Greta Raymant Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2775 Species: Caenorhabditis elegans Genotype: cct-2(ok3438)/mIn1[mIs14 dpy-10(e128)] II. Description: T21B10.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3438 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGATCCTGAAGTCAATCGGT. External right primer: CAGCAACCTCTCCTTTCTCG. Internal left primer: TCCTCAAAGAAGCCGAGAAA. Internal right primer: AATGAACAAACCGATTCCCA. Internal WT amplicon: 1112 bp. Deletion size: 633 bp. Deletion left flank: AAGATTCTCATTGCCAACACACCAATGGAC. Deletion right flank: GACTCGGCTGAACTTGTCACAAGACTCCGT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Greta Raymant Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2776 Species: Caenorhabditis elegans Genotype: +/mT1 II; rnr-2(ok3357)/mT1[dpy-10(e128)] III. Description: C03C10.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3357 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTCTCTCGGCTTCATTCACC. External right primer: GTGTAAAGTCCGCGAAGAGG. Internal left primer: ATACTCGGAAACCCGCTTCT. Internal right primer: ATGCCTTCGAATTTACAGCC. Internal WT amplicon: 1159 bp. Deletion size: 691 bp. Deletion left flank: TTCGATGGCCACAGCGTCCTTGATGATATC. Deletion right flank: TGCCTTTTTGTAGAAGTTCCAGATGTCATG. Insertion Sequence: ATTGATGA. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Angela Miller Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2785 Species: Caenorhabditis elegans Genotype: lsm-4&ada-2(ok3151)/mIn1[mIs14 dpy-10(e128)] II. Description: F32A5.7, F32A5.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3151 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GTTGGAGGTGCGGACATTAT. External right primer: ATGATCATCCACCAACGACC. Internal left primer: GGAATGTCGTTATTCGATTTTGA. Internal right primer: TTTCGAATTGTCTTTTCGCC. Internal WT amplicon: 1193 bp. Deletion size: 437 bp. Deletion left flank: ACCACCACGACCACGGGATTGCTCGCGCTG. Deletion right flank: AATATTCATCCACGAATCGCAGGCTTTCAG. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Greta Raymant Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2787 Species: Caenorhabditis elegans Genotype: +/mT1 II; knl-1(ok3457)/mT1[dpy-10(e128)] III. Description: C02F5.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3457 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCGATGGAATTGGACAACA. External right primer: ATTGTAGGCCTGATGCAAGG. Internal left primer: AGGCCATAATGAAACATCGC. Internal right primer: GTGAAGGCGGCATCTAAAAT. Internal WT amplicon: 1188 bp. Deletion size: 602 bp. Deletion left flank: GAATGGGCAAACAATGGAAGCTCTGACAGA. Deletion right flank: CAGCTAAGAGGTCTCGATAAGATGGCTGTC. Insertion Sequence: GGAAATTCGAAAATGGCTGAA. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Greta Raymant Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2791 Species: Caenorhabditis elegans Genotype: egl-38(ok3510) IV/nT1[qIs51](IV;V). Description: C04G2.7. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3510 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTCCCTACCCTACCCTCTG. External right primer: CGACTCCACAGTGCTTTCAG. Internal left primer: GCCCGGTTTTACCCTGTATT. Internal right primer: TTCCGCCTCAAAAGTTTCTC. Internal WT amplicon: 1203 bp. Deletion size: 786 bp. Deletion left flank: AAAATTTTACAAATTAAGCGAATAATACTT. Deletion right flank: GCGATTACAAAATTAATTTGTATTCCTTAT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Greta Raymant Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2792 Species: Caenorhabditis elegans Genotype: sar-1(ok3513) IV/nT1[qIs51](IV:V). Description: ZK180.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3513 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTATGCACAAACGTCGAAGG. External right primer: TTCTCACCCCCATTTAACCA. Internal left primer: ATCCCAAGGATCCCAAAAGA. Internal right primer: AAAATGCCTGATTTACCCGA. Internal WT amplicon: 1167 bp. Deletion size: 425 bp. Deletion left flank: ATTCCTTCTCCGTATCCTTGTCGCTGAAGA. Deletion right flank: TCGTATGTGGTAAACGAAATTCCTCCGAGT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Greta Raymant Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2800 Species: Caenorhabditis elegans Genotype: F15D4.3(ok3493)/mT1 II; +/mT1[dpy-10(e128)] III. Description: F15D4.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3493 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGATTCGGCAAGAGAGGTCA. External right primer: AAAGTTTTGCTCCTGTGCGT. Internal left primer: TAATAATCCCTTGAGCCCCC. Internal right primer: AACGATTTCTTTCACAAAGTGGA. Internal WT amplicon: 1187 bp. Deletion size: 531 bp. Deletion left flank: ATTGAGTTTTTTCTATGAAAGACCTAGCGC. Deletion right flank: AAAAATAAAATAAATAACACGGAAACCGCG. Insertion Sequence: AA. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Greta Raymant Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2803 Species: Caenorhabditis elegans Genotype: rpl-31(ok3358)/hIn1[unc-101(sy241)] I. Description: W09C5.6. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3358 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ACGTTACCATCAAGGCTCCA. External right primer: ATCGTCCCGTTTTGTGAGTC. Internal left primer: CTTCTGTTCTCCCCCAACCT. Internal right primer: TGCAAGTATGCTCCGTTGAA. Internal WT amplicon: 1101 bp. Deletion size: 640 bp. Deletion left flank: GACGGACACGAACTCTGTATGGAACGTTCT. Deletion right flank: AGTAGGAGCTTTATTTCAGAGAGAAAACAT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Lucy Liu Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2819 Species: Caenorhabditis elegans Genotype: F15D4.3(ok3521)/mT1 II; +/mT1[dpy-10(e128)] III. Description: F15D4.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3521 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGATTCGGCAAGAGAGGTCA. External right primer: AAAGTTTTGCTCCTGTGCGT. Internal left primer: TAATAATCCCTTGAGCCCCC. Internal right primer: AACGATTTCTTTCACAAAGTGGA. Internal WT amplicon: 1187 bp. Deletion size: 378 bp. Deletion left flank: CTTCTCTTCTCCCTGTGTGTACCAGTGTAC. Deletion right flank: TCGAATCTGGAAATTTTGAAAATAAATTAG. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Greta Raymant Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2820 Species: Caenorhabditis elegans Genotype: eat-2(ok3528)/mT1 II; +/mT1[dpy-10(e128)] III. Description: Y48B6A.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3528 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTTTTCTCCGCACTCTGGT. External right primer: TGTGGCACAGAACTACGCTC. Internal left primer: CCAAAATGTTGCTCAACGAG. Internal right primer: CGCAAGCCTGTAAATGTGAA. Internal WT amplicon: 1182 bp. Deletion size: 614 bp. Deletion left flank: AAATGTTGCTCAACGAGATCAAAATCGATG. Deletion right flank: TAGGGGTACTGTAGGACAACTGTGGAAGTA. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Greta Raymant Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC2837 Species: Caenorhabditis elegans Genotype: +/mT1 II; ugtp-1(ok3492)/mT1[dpy-10(e128)] III. Description: ZK370.7. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3492 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCAATCCGTTTCTGTCGTCT. External right primer: ATGATGCTCTTTCTCGGTCG. Internal left primer: TTGGCGAGAATTTATGAGCC. Internal right primer: TCGATGGATGGCAATTACAC. Internal WT amplicon: 1168 bp. Deletion size: 505 bp. Deletion left flank: TTAAGTTTATACAATTAAAGCTTTTGGCTA. Deletion right flank: TTTTTCAAACGATTTGAAAAAAAAACCCTA. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: EMS Outcrossed: x1 Reference: Made by: Lucy Liu Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: VC10116 Species: Caenorhabditis elegans Genotype: math-34(gk1188) II. Description: M01D1.2. Homozygous. Detected by CGH (Comparative Genome Hybridization). Minimum deletion size: 345 bp; maximum size 5952 bp. Left flanking probe: TGAAATCGGTGAGCTTTTGGTCTGGGTAAGCTCTCAGGAGGAGCCAGCCT. Right flanking probe: CTATTCAACCCCCATGCGTTGGATGAAGCCTTCCCAATGTCCAACCTTTA. Left deleted probe: AAGCCCTGCGATCACTGGTAAGCTCCTGATCACCCTATTACTTGCACAGT. Right deleted probe: AATCGCAGAGATTGTCAGCGACTTGAAGCTCGGCGGATTGGACAGGCCGT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data." This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: UV/TMP Outcrossed: x0 Reference: Made by: Vancouver KO Group Received: 09/30/09 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: RB5000 Species: Caenorhabditis elegans Genotype: dpy-1(ok5083) III. Description: Dpy. It has not been confirmed that this phenotype is the result of ok5083. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to ok5083, it is homozygous for 196 other mutations determined from sequence data. All mutations are annotated in WormBase. Mutagen: EMS Outcrossed: x0 Reference: Made by: OMRF KO Group Received: 10/21/10 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: RB5001 Species: Caenorhabditis elegans Genotype: whole genome sequenced strain. Description: Dpy. The mutation responsible for this phenotype has not been identified. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). It is homozygous for 289 mutations determined from sequence data, all of which are annotated in WormBase. Mutagen: EMS Outcrossed: x0 Reference: Made by: OMRF KO Group Received: 10/21/10 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: RB5002 Species: Caenorhabditis elegans Genotype: whole genome sequenced strain. Description: Unc. The mutation responsible for this phenotype has not been identified. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). It is homozygous for 477 mutations determined from sequence data, all of which are annotated in WormBase. Mutagen: EMS Outcrossed: x0 Reference: Made by: OMRF KO Group Received: 10/21/10 from Moerman D, C. elegans Reverse Genetics Core, Vancouver, BC, Canada -------------------- Strain: GC827 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; naIs7. Description: naIs7[pGC146(Phsp-16.2::FLP::let-858 3'utr) + Cbr-unc-119(+)]. Does not express Pceh-22::GFP, but unc-119 is rescued. Mutagen: Outcrossed: x0 Reference: Made by: R. Voutev/J. Hubbard Received: 07/15/09 from Hubbard J, New York University, New York, NY -------------------- Strain: AA1 Species: Caenorhabditis elegans Genotype: daf-12(rh257) X. Description: daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele. Occasional abnormal dauers under exhausted conditions. Mutagen: EMS Outcrossed: x Reference: CGC #3064 Antebi A;Culotti JG;Hedgecock EM daf-12 regulates developmental age and the dauer alternative in Caenorhabditis elegans. Development 125: 1191-1205 1998 Made by: Adam Antebi Received: 10/23/00 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA6 Species: Caenorhabditis elegans Genotype: daf-12(rh84) X. Description: daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele. Mutagen: EMS Outcrossed: x2 Reference: CGC #3064 Antebi A;Culotti JG;Hedgecock EM daf-12 regulates developmental age and the dauer alternative in Caenorhabditis elegans. Development 125: 1191-1205 1998 Made by: Ed Hedgecock Received: 10/23/00 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA10 Species: Caenorhabditis elegans Genotype: daf-12(rh286) X. Description: Weak heterochronic phenotypes in seam, intestine, somatic gonad. Class V allele. Mutagen: EMS Outcrossed: x4 Reference: CGC #3064 Antebi A;Culotti JG;Hedgecock EM daf-12 regulates developmental age and the dauer alternative in Caenorhabditis elegans. Development 125: 1191-1205 1998 Made by: Adam Antebi Received: 10/23/00 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA18 Species: Caenorhabditis elegans Genotype: daf-12(rh61rh412) X. Description: daf-d. Weak heterochronic phenotypes in seam, somatic gonad and intestine. Class III allele. Mutagen: Spontaneous Outcrossed: x Reference: CGC #4181 Antebi A;Yeh WH;Tait D;Hedgecock EM;Riddle DL daf-12 encodes a nuclear receptor that regulates the dauer diapause and developmental age in C. elegans. Genes & Development 14: 1512-1527 2000 Made by: Adam Antebi Received: 11/03/00 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA34 Species: Caenorhabditis elegans Genotype: daf-12(rh61) X. Description: daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele. Mutagen: EMS Outcrossed: x2 Reference: CGC #3064 Antebi A;Culotti JG;Hedgecock EM daf-12 regulates developmental age and the dauer alternative in Caenorhabditis elegans. Development 125: 1191-1205 1998 Made by: Ed Hedgecock Received: 10/23/00 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA82 Species: Caenorhabditis elegans Genotype: daf-12(rh284) X. Description: Gonadal lead cell Mig. Weak heterochronic phenotype in intestine. Weakly daf-c at 25C. Class V allele. Mutagen: EMS Outcrossed: x2 Reference: CGC #3064 Antebi A;Culotti JG;Hedgecock EM daf-12 regulates developmental age and the dauer alternative in Caenorhabditis elegans. Development 125: 1191-1205 1998 Made by: Adam Antebi Received: 10/23/00 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA83 Species: Caenorhabditis elegans Genotype: daf-12(rh62rh157) X. Description: daf-d. Strong heterochronic phenotypes in seam and intestine. Weak heterochronic phenotypes in somatic gonad. Class II allele. Mutagen: Spontaneous revertant Outcrossed: x3 Reference: CGC #3064 Antebi A;Culotti JG;Hedgecock EM daf-12 regulates developmental age and the dauer alternative in Caenorhabditis elegans. Development 125: 1191-1205 1998 Made by: Ed Hedgecock Received: 10/23/00 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA85 Species: Caenorhabditis elegans Genotype: daf-12(rh285) X. Description: Strong heterochronic phenotypes in seam, somatic gonad and intestine. Weakly daf-c at 15C. Class IV allele. Mutagen: EMS Outcrossed: x2 Reference: CGC #4181 Antebi A;Yeh WH;Tait D;Hedgecock EM;Riddle DL daf-12 encodes a nuclear receptor that regulates the dauer diapause and developmental age in C. elegans. Genes & Development 14: 1512-1527 2000 Made by: Adam Antevi Received: 11/03/00 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA86 Species: Caenorhabditis elegans Genotype: daf-12(rh61rh411) X. Description: Daf-d, weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele. Mutagen: Spontaneous revertant Outcrossed: x2 Reference: CGC #3064 Antebi A;Culotti JG;Hedgecock EM daf-12 regulates developmental age and the dauer alternative in Caenorhabditis elegans. Development 125: 1191-1205 1998 Made by: Adam Antebi Received: 10/23/00 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA87 Species: Caenorhabditis elegans Genotype: daf-12(rh273) X. Description: Daf-c, gonadal Mig, weak heterochronic phenotypes in intestine and seam. Class VI allele. Mutagen: EMS Outcrossed: x3 Reference: CGC #3064 Antebi A;Culotti JG;Hedgecock EM daf-12 regulates developmental age and the dauer alternative in Caenorhabditis elegans. Development 125: 1191-1205 1998 Made by: Adam Antebi Received: 10/23/00 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA88 Species: Caenorhabditis elegans Genotype: daf-12(rh193) X. Description: Strong heterochronic phenotypes in seam, somatic gonad and intestine. Heterochronic phenotypes less penetrant at 15C. Weakly daf-c at 25C. Class IV allele. Mutagen: Outcrossed: x3 Reference: CGC #4181 Antebi A;Yeh WH;Tait D;Hedgecock EM;Riddle DL daf-12 encodes a nuclear receptor that regulates the dauer diapause and developmental age in C. elegans. Genes & Development 14: 1512-1527 2000 Made by: Adam Antebi Received: 11/03/00 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA89 Species: Caenorhabditis elegans Genotype: daf-12(rh274) X. Description: daf-c. Gonald Mig. Weak heterochronic phenotypes in intestine. Class VI allele. Mutagen: EMS Outcrossed: x3 Reference: CGC #4181 Antebi A;Yeh WH;Tait D;Hedgecock EM;Riddle DL daf-12 encodes a nuclear receptor that regulates the dauer diapause and developmental age in C. elegans. Genes & Development 14: 1512-1527 2000 Made by: Adam Antebi Received: 11/03/00 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA107 Species: Caenorhabditis elegans Genotype: nhr-48(ok178) X. Description: ZK662.3 Homozygous. No obvious phenotype. Outer left primer sequence: TCTGAAGTTTGTGAGCCGTG. Outer right primer sequence: AGCGCCTAGATGAGCAACAT. Inner left primer sequence: TCCGTTGAATGCCATCTGTA. Inner right primer sequence: GGACGATGCACATGAGTTTG. Inner primer PCR product length: 3324 bp. Deletion size: 1956 bp. Mutagen: UV/TMP Outcrossed: x2 Reference: Made by: Adam Antebi Received: 08/19/03 from Sluder A, Cambria Biosciences, Bedford, MA -------------------- Strain: AA120 Species: Caenorhabditis elegans Genotype: dhIs26. Description: dhIs26[daf-12A::GFP + lin-15(+)]. DAF-12::GFP localized primarily in nucleus, except during mitosis. Expressed widely in most cells including tissues modified for dauer formation or by stage from embryo to adult, but most elevated and widespread during L2. Mutagen: UV Outcrossed: x3 Reference: Made by: C. Kober-Eisermann Received: 03/23/07 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA278 Species: Caenorhabditis elegans Genotype: dhIs59. Description: dhIs59[Topo::daf-9::GFP + lin-15(+)]. Expressed in a ventral pair of bilateral neurons identified as the IL1Vs or URAVs in the anterior ganglia; perinuclear. By mid-L2, expression in the cytoplasm of the hypodermis, the syncitial epidermis, but absent from midline, epidermal seam cells. Levels peak around the L2 molt and diminish during L4. In some cases, transient expression seen in the L3 vulval blast cells. Also expressed within the hermaphrodite spermatheca starting in late L4 larvae and continuing eve in old adults. In males, expression in IL1V/URAVs and hypodermis but not somatic gonad. In dauer larvae, strong expression in IL1V/URAv and specifically extends into axonal but not dendritic processes. In post-dauer stages, expression in a pattern similar to reproductively growing animals, except expression is absent in the hypodermis. Grow at 20C. May still contain lin-15(n765) mutation in the background. Mutagen: UV Outcrossed: x3 Reference: Made by: C. Kober-Eisermann Received: 03/23/07 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA292 Species: Caenorhabditis elegans Genotype: daf-36(k114) V. Description: Mig on low cholesterol. Single daf-C at 27C, weak Mig. Strong expression in intestine at all stages. Grow at 20C. Mutagen: Outcrossed: x Reference: Made by: Veerle Rottiers Received: 03/23/07 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA408 Species: Caenorhabditis elegans Genotype: din-1(dh127) II. Description: daf-d, suppresses daf-12(rh61) daf-12(rh274) gonadal migration defects. Mutagen: EMS Outcrossed: x3 Reference: Made by: Andreas Ludewig Received: 01/28/08 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA411 Species: Caenorhabditis elegans Genotype: din-1(dh149) II. Description: daf-d, suppresses daf-12(rh61) daf-12(rh274) gonadal migration defects. Mutagen: EMS Outcrossed: x3 Reference: Made by: Andreas Ludewig Received: 01/28/08 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA426 Species: Caenorhabditis elegans Genotype: dre-1(dh99) V. Description: Precocious fusion of ceam cells one stage earlier prior to L3 molt; impenetrant gonadal migration defects; SynMig on daf-12 RNAi. Mutagen: EMS Outcrossed: x3 Reference: Made by: Nicole Fielenbach Received: 04/02/07 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA699 Species: Caenorhabditis elegans Genotype: din-1(hd36) II. Description: non-Daf. Temperature sensitive phenotypes: at 20C half of the animals are egg-laying defective with occasional mispositioned gonadal arms; at 25C, 18% arrest as embryos: those animals that hatch usually display variable morphology defects in body and pharynx; nearly all animals that live to adults were small, clear, and slightly uncoordinated, constipated, and virtually sterile. Maintain at 20C or below. Mutagen: Outcrossed: x Reference: Made by: Harald Hutter Received: 01/28/08 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA776 Species: Caenorhabditis elegans Genotype: cyp-44A1(ok216) II. Description: Mutagen: UV/TMP Outcrossed: x0 Reference: Made by: OMRF Knockout Group Received: 07/22/03 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AA790 Species: Caenorhabditis elegans Genotype: lin-15B(n765) X; dhEx343. Description: dhEx343[lin-15(+) + L3781::din1pdin-1E::GFP]. din-1S::GFP is detected in hypodermis, seam, intestine, and somatic gonad including the distal tip cells. din-1S is also expressed in neurons, vulval precursors, body wall muscle, pharynx, and all tissues with heterochronic phenotypes or remodeled during dauer. Expression is first detected in a few nuclei by the comma stage of embryogenesis. By hatching, din-1S was widely expressed, albeit weakly. Overall expression in most tissues is detected at various levels into adult and in dauer larvae. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and GFP-. Mutagen: Outcrossed: x Reference: Made by: Kerstin Neubert Received: 07/02/07 from Antebi A, Max Planck Institute, Cologne, Germany -------------------- Strain: AB1 Species: Caenorhabditis elegans Genotype: C. elegans wild isolate. Description: Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VII). Mutagen: Outcrossed: x Reference: CGC #2770 Hodgkin J;Doniach T Natural variation and copulatory plug formation in Caenorhabditis elegans. Genetics 146: 149-164 1997 Made by: Received: 09/01/84 from Bird A, CSIRO, Adelaide, Australia -------------------- Strain: AB2 Species: Caenorhabditis elegans Genotype: C. elegans wild isolate. Description: Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VIII). Mutagen: Outcrossed: x Reference: CGC #2770 Hodgkin J;Doniach T Natural variation and copulatory plug formation in Caenorhabditis elegans. Genetics 146: 149-164 1997 Made by: Received: 09/01/84 from Bird A, CSIRO, Adelaide, Australia -------------------- Strain: AB3 Species: Caenorhabditis elegans Genotype: C. elegans wild isolate. Description: Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VIII). Mutagen: Outcrossed: x Reference: CGC #2770 Hodgkin J;Doniach T Natural variation and copulatory plug formation in Caenorhabditis elegans. Genetics 146: 149-164 1997 Made by: Received: 09/01/84 from Bird A, CSIRO, Adelaide, Australia -------------------- Strain: AB4 Species: Caenorhabditis elegans Genotype: C. elegans wild isolate. Description: Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VIII). Mutagen: Outcrossed: x Reference: CGC #2770 Hodgkin J;Doniach T Natural variation and copulatory plug formation in Caenorhabditis elegans. Genetics 146: 149-164 1997 Made by: Received: 09/01/84 from Bird A, CSIRO, Adelaide, Australia -------------------- Strain: ABR1 Species: Caenorhabditis elegans Genotype: pha-1(e2123) III; staEx1. Description: staEx1 [T20F7.6p + pha-1(+)]. Empty vector control strain. Maintain at 25 degrees. Superficially wild-type. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56. Mutagen: Outcrossed: x0 Reference: Made by: Eric Greer Received: 04/22/10 from Brunet A, Stanford University, Stanford, CA -------------------- Strain: ABR4 Species: Caenorhabditis elegans Genotype: pha-1(e2123) III; staEx4. Description: staEx4 [T20F7.6p(R81Q)::T20F7.6 + pha-1(+)]. Constitutively active T20f7.6 promoter construct (CA3). Maintain at 25 degrees. Superficially wild-type with increased lifespan and stress resistance. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56. Mutagen: Outcrossed: x0 Reference: Made by: Eric Greer Received: 04/22/10 from Brunet A, Stanford University, Stanford, CA -------------------- Strain: ABR5 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; staIs1. Description: staIs1 [pie-1p::GFP + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: This strain is used as the empty vector control in Greer EL et al Nature 2010 doi: 10.1038/nature09195. Mutagen: bombardment Outcrossed: x0 Reference: Made by: Eric Greer Received: 06/14/10 from Brunet A, Stanford University, Stanford, CA -------------------- Strain: ABR7 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; staIs2. Description: staIs2 [pie-1p::rbr-2::GFP + unc-119(+)]. Extended longevity. Maintain under normal conditions. Reference: This strain is used as LC Ppie-1::rbr-2::GFP (#3) in Greer EL et al Nature 2010 doi: 10.1038/nature09195. Mutagen: bombardment Outcrossed: x0 Reference: Made by: Eric Greer Received: 06/14/10 from Brunet A, Stanford University, Stanford, CA -------------------- Strain: ABR9 Species: Caenorhabditis elegans Genotype: set-2(ok952) III; rbr-2(tm1231) IV. Description: Reduced lifespan. Maintain under normal conditions. The parental rbr-2 strain was outcrossed 6x and the parental set-2 strain was outcrossed 2x. Reference: Greer EL et al Nature (2010) doi: 10.1038/nature09195. Mutagen: Outcrossed: x Reference: Made by: Eric Greer Received: 06/17/10 from Brunet A, Stanford University, Stanford, CA -------------------- Strain: ABR10 Species: Caenorhabditis elegans Genotype: wdr-5.1(ok1417) III; rbr-2(tm1231) IV. Description: Reduced lifespan. Maintain under normal conditions. The parental rbr-2 strain was outcrossed 6x and the parental wdr-5 strain was outcrossed 2x. Reference: Greer EL et al Nature (2010) doi: 10.1038/nature09195. Mutagen: Outcrossed: x Reference: Made by: Eric Greer Received: 06/17/10 from Brunet A, Stanford University, Stanford, CA -------------------- Strain: AC68 Species: Caenorhabditis elegans Genotype: unc-29(e1072) aph-2(zu181)/unc-13(e1091) lin-11(n566) I. Description: Heterozygotes are WT and segregate WT, Unc Egls, and dead eggs. Mutagen: Tc1 Outcrossed: x10 Reference: CGC #4188 Goutte C;Hepler W;Mickey KM;Priess JR aph-2 encodes a novel extracellular protein required for GLP-1-mediated signaling. Development 127: 2481-2492 2000 Made by: Received: 11/09/00 from Goutte C, Amherst College, Amherst, MA -------------------- Strain: AC257 Species: Caenorhabditis elegans Genotype: ppk-3(n2668) X. Description: Growth retardation, enlarged vacuoles (late endosomes and lysosomes) in intestine, epidermis, coelomocytes and pharynx. 27% embryonic lethality and 8% post-embryonic lethality. Mutagen: EMS Outcrossed: x8 Reference: Made by: Andrew Chisholm Received: 04/25/07 from Labouesse M, IGBMC, Strasbourg, France -------------------- Strain: AD186 Species: Caenorhabditis elegans Genotype: egg-1(tm1071) III. Description: Temperature sensitive sterile. Fertility is <10% of WT at 25C. Grow at 20C. For phenotype, grow at 25C. Mutagen: UV/TMP Outcrossed: x>3 Reference: Made by: S. Mitani Received: 01/17/06 from Singson A, Waksman Institute, Piscataway, NJ -------------------- Strain: AD189 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; asIs2. Description: asIs2[unc-119(+) + ppie-1::GFP::egg-1]. Oocyte membranes are green. Mutagen: Microparticle bombardment Outcrossed: x Reference: Made by: Received: 03/27/06 from Singson A, Waksman Institute, Piscataway, NJ -------------------- Strain: AD200 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; asIs1. Description: asIs1[unc-119(+) + pie-1::GFP::egg-3]. Mutagen: Outcrossed: x3 Reference: Made by: Rika Maruyama Received: 03/20/08 from Singson A, Waksman Institute, Piscataway, NJ -------------------- Strain: AD226 Species: Caenorhabditis elegans Genotype: egg-3(tm1191)/mIn1[mIs14 dpy-10(e128)] II. Description: Heterozygotes are WT and GFP+. mIn1 homozygotes are Dpy and GFP+. egg-3 homozygotes are non-GFP. Mutagen: Outcrossed: x3 Reference: Made by: Japanese KO Consort. Received: 03/20/08 from Singson A, Waksman Institute, Piscataway, NJ -------------------- Strain: AD238 Species: Caenorhabditis elegans Genotype: asIs2. Description: asIs2[pie-1::mcherry::egg-3]. Mutagen: Outcrossed: x3 Reference: Made by: Rika Maruyama Received: 03/20/08 from Singson A, Waksman Institute, Piscataway, NJ -------------------- Strain: AD265 Species: Caenorhabditis elegans Genotype: nnIs2. Description: nnIs2[unc-119(+) Ppie-1::GFP::chs-1]. Mutagen: Outcrossed: x3 Reference: Made by: Rika Maruyama Received: 06/25/08 from Singson A, Waksman Institute, Piscataway, NJ -------------------- Strain: AD266 Species: Caenorhabditis elegans Genotype: egg-4(tm1508) egg-5(ok1781) I/hT2[bli-4(e937) let-?(q782) qIs48](I;III). Description: Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1508 ok1781 homozygotes (maternal sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Parry JM, et al 2009 Current Biology 19(20):1752-7. Mutagen: Outcrossed: x Reference: Made by: Jean Parry Received: 12/15/09 from Singson A, Waksman Institute, Piscataway, NJ -------------------- Strain: AD271 Species: Caenorhabditis elegans Genotype: spe-38(eb44) I; him-5(e1490) V; asEx78. Description: asEx78 [spe-38p::spe-38(cDNA)::spe-38 3'UTR + myo-3p::GFP]. Pick GFP+ to maintain. GFP+ worms are fertile; animals that have lost the array are sterile. Mutagen: Outcrossed: x Reference: Made by: G. Singaravelu Received: 06/01/11 from Singson A, Waksman Institute, Piscataway, NJ -------------------- Strain: AE501 Species: Caenorhabditis elegans Genotype: nhr-8(ok186) IV. Description: Approx. 1.3 kb deletion - does not remove entire coding region, may not be null allele. No overt morphological or behavioral abnormalities. Homozygotes are 2-3X more sensitive to colchicine and chloroquine than are N2 animals. Mutagen: EMS Outcrossed: x4 Reference: CGC #4723 Lindblom TH;Pierce GJ;Sluder AE A C. elegans orphan nuclear receptor contributes to xenobiotic resistance. Current Biology 11: 864-868 2001 Made by: Moulder/Lindblom Received: 08/30/01 from Sluder A, Cambria Biosciences, Bedford, MA -------------------- Strain: AF1 Species: Caenorhabditis elegans Genotype: +/szT1[lon-2(e678)] I; dpy-8(e1321) unc-3(e151)/szT1 X. Description: Heterozygotes are WT and segregate WT, DpyUnc, dead eggs and Lon males. Maintain by picking WT. Mutagen: X-ray Outcrossed: x Reference: CGC #576 Fodor A;Deak P Isolation and phenocritical period-analysis of conditional and non-conditional developmental mutants in C. elegans. Acta Biologica Academiae Scientiarum Hungaricae 32: 229-239 1982 Made by: Fodor A Received: 05/01/81 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF5 Species: Rhabditis sp. Genotype: Rhabditis sp. wild isolate Description: Isolated in Towers Hill State Park in WI. Males are rare. No SDS resistant dauers. Animals are osmosensitive, can be dried competely and recover in water. Rhabditidae. Mutagen: Outcrossed: x Reference: Made by: Andras Fodor Received: 08/21/95 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF13(4) Species: Oscheius akosreti Genotype: Oscheius akosreti wild isolate. Description: Isolated in Memorial Park in Madison, WI. No hermaphrodites. Lots of SDS resistant dauers. They grow very slowly at 15C. Can survive between 15-28C. Mutagen: Outcrossed: x Reference: Made by: Andras Fodor Received: 08/21/95 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF16 Species: Caenorhabditis briggsae Genotype: C. briggsae wild isolate. Description: See WBG 7(1) 48. Isolated from soil in Ahmedabad, India. Previously called C. briggsae G16. Mutagen: Outcrossed: x Reference: CGC #692 Fodor A;Riddle DL;Nelson FK;Golden JW Comparison of a new wild-type Caenorhabditis briggsae with laboratory strains of C. briggsae and C. elegans. Nematologica 29: 203-217 1983 Made by: Andras Fodor Received: 02/01/82 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF23 Species: Mesorhabditis sp. Genotype: Mesorhabditis sp. wild isolate. Description: Stock may be lost!! Growing stock at CGC lost, and didn't survive freezing well, so the freezer vials may not contain any live animals. Dark in color. Seems to grow better at 25C than 15C or 20C. Rhabditidae: Mesorhabditis sp. Mutagen: Outcrossed: x Reference: Made by: Andras Fodor Received: 08/21/95 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF25 Species: Unknown species Genotype: Unknown species wild isolate Description: Mutagen: Outcrossed: x Reference: Made by: Andras Fodor Received: 08/21/95 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF36 Species: Panagrolaimus rigidus Genotype: Panagrolaimus rigidus wild isolate. Description: Panagrolaimus rigidus (Schneider, 1886). Males and females. Animals are long. Mutagen: Outcrossed: x Reference: CGC #3766 Cunha A;Azevedo RBR;Emmons SW;Leroi AM Variable cell number in nematodes. Nature 402: 253 1999 Made by: Andras Fodor Received: 08/21/95 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF37 Species: Mesorhabditis sp. Genotype: Mesorhabditis sp. wild isolate. Description: SDS resistant dauers. Rhabditida: Mesorhabditis sp. Mutagen: Outcrossed: x Reference: Made by: Andras Fodor Received: 08/21/95 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF40 Species: Panagrolaimus rigidus Genotype: Panagrolaimus rigidus wild isolate. Description: Panagrolaimidae: P. rigidus (Schneider, 1866). Long animals. Dig themselves into the agar. Mutagen: Outcrossed: x Reference: Made by: Andras Fodor Received: 08/21/95 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF72 Species: Mesorhabditis miotki Genotype: Mesorhabditis miotki wild isolate. Description: Rhabditidae: Mesorhabditis miotki, Sudhaus, 1978. Isolated in Pennsylvania. Mutagen: Outcrossed: x Reference: Made by: Andras Fodor Received: 08/21/95 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF78 Species: Mesorhabditis sp. Genotype: Mesorhabditis sp. wild isolate. Description: Rhabditidae: Mesorhabditis sp. Isolated in Governor Dodge State Park in South Dakota. Dark in color. Mutagen: Outcrossed: x Reference: Made by: Andras Fodor Received: 08/21/95 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF271 Species: Unknown species Genotype: Unknown species wild isolate Description: Mutagen: Outcrossed: x Reference: Made by: Andras Fodor Received: 08/21/95 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF272 Species: Unknown species Genotype: Unknown species wild isolate Description: Dark in color. Mutagen: Outcrossed: x Reference: Made by: Andras Fodor Received: 08/21/95 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF6733 Species: Unknown species Genotype: Unknown species wild isolate Description: Isolated in Pennsylvania. SDS resistant dauers. males rare. Mutagen: Outcrossed: x Reference: Made by: Andras Fodor Received: 08/21/95 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF6840 Species: Unknown species Genotype: Unknown species wild isolate Description: Isolated in Pennsylvania. Males are rare. Mutagen: Outcrossed: x Reference: Made by: Andras Fodor Received: 08/21/95 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF7340 Species: Unknown species Genotype: Unknown species wild isolate Description: Isolated in Ohio. Mutagen: Outcrossed: x Reference: Made by: Andras Fodor Received: 08/21/95 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF8032 Species: Unknown species Genotype: Unknown species wild isolate Description: Isolated at Niagara Falls in Canada. SDS resistant dauers look like C. elegans predauers. Males are rare. Mutagen: Outcrossed: x Reference: Made by: Andras Fodor Received: 08/21/95 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AF8130 Species: Pristionchus sp. Genotype: Pristionchus sp. wild isolate. Description: Neodiplogasteridae: Pristionchus Iheritieri, Maupas, 1919. Isolated in Ontario, Canada. [9/98: Ralf Sommer has found this strain to be hermaphroditic. He had successful matings between AF8130 and PS312 Pristionchus pacificus, indicating that AF8130 is probably P. pacificus.] Mutagen: Outcrossed: x Reference: Made by: Andras Fodor Received: 08/21/95 from Fodor A, Hungarian Academy of Science, Szeged -------------------- Strain: AG50 Species: Caenorhabditis elegans Genotype: daf-7(e1372) dpy-1(e1) Description: Dpy. Temperature sensitive dauer constitutive. Crowds. 100% dauers at 25C. Leaky at 20C. Maintain at 15C. Mutagen: Outcrossed: x Reference: Made by: Andy Golden Received: 08/27/99 from Golden A, NIDDK/NIH, Bethesda, MD -------------------- Strain: AG150 Species: Caenorhabditis elegans Genotype: mat-2(ar104)/unc-4(e120) bli-1(e769) II. Description: Heterozygotes are WT and segregate WT, UncBli, and Steriles which have an everted vulva. ar104 previously called evl-22. Mutagen: Outcrossed: x Reference: CGC #1738 Seydoux G;Savage C;Greenwald I Isolation and characterization of mutations causing abnormal eversion of the vulva in Caenorhabditis elegans. Developmental Biology 157: 423-436 1993 Made by: Andy Golden Received: 05/30/01 from Golden A, NIDDK/NIH, Bethesda, MD -------------------- Strain: AG151 Species: Caenorhabditis elegans Genotype: cdc-25.1(nr2036)/dpy-5(e61) unc-13(e450) I. Description: Heterozygotes are WT and segregate WT, DpyUncs and adult steriles. Original deletion from Axys Pharmaceuticals. Mutagen: UV/TMP Outcrossed: x10 Reference: CGC #5294 Ashcroft N;Golden A CDC-25.1 regulates germline proliferation in Caenorhabditis elegans. Genesis 33: 1-7 2002 Made by: Ashcroft/Golden Received: 01/24/03 from Golden A, NIDDK/NIH, Bethesda, MD -------------------- Strain: AG152 Species: Caenorhabditis elegans Genotype: unc-85(e1414) bli-2(e768) dpy-10(e128) II. Description: Unc and Dpy. Not Blistered: dpy-10 suppresses the appearance of the blisters. Mutagen: Outcrossed: x Reference: Made by: Andy Golden Received: 06/17/05 from Golden A, NIDDK/NIH, Bethesda, MD -------------------- Strain: AG165 Species: Caenorhabditis elegans Genotype: san-1(av31) unc-13(e450) I. Description: Reduced brood size. Larval lethal, larval arrest. Steriles. Bursts at vulva. Can be maintained as a homozygote. Unc. Mutagen: EMS Outcrossed: x3 Reference: Made by: Ed Davis Received: 05/01/07 from Golden A, NIDDK/NIH, Bethesda, MD -------------------- Strain: AG166 Species: Caenorhabditis elegans Genotype: mdf-2(av16) unc-17(e245) IV. Description: Reduced brood size. Reduced hatching. Slow growth. Larval lethal. Larval arrest. Bursts at vulva. Suppresses the mat-3 one-cell arrest at 25C. Mutagen: EMS Outcrossed: x3 Reference: Made by: Received: 05/09/07 from Golden A, NIDDK/NIH, Bethesda, MD -------------------- Strain: AG168 Species: Caenorhabditis elegans Genotype: fzy-1(av15) unc-4(e120) II. Description: Unc. Gain-of-function allele of fzy-1. Mutagen: EMS Outcrossed: x Reference: Made by: Andy Golden Received: 06/06/07 from Golden A, NIDDK/NIH, Bethesda, MD -------------------- Strain: AG171 Species: Caenorhabditis elegans Genotype: mdf-1(av19) unc-42(e270) V. Description: Unc. Previously called AG164 by the CGC. Mutagen: EMS Outcrossed: x Reference: Made by: Andy Golden Received: 05/01/07 from Golden A, NIDDK/NIH, Bethesda, MD -------------------- Strain: AG175 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; avEx122 Description: avEx122 is [pAG126 (lpin-1p::GFP::lpin-1::lpin-1 3'utr + unc-119(+)] No GFP expression detected in germline. Mutagen: Bombardment Outcrossed: x Reference: Made by: Orna Cohen-Fix Received: 07/02/09 from Cohen-Fix O, NIH, NIDDK, Bethesda, MD -------------------- Strain: AG176 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; avEx123 Description: avEx123 is [lpin-1p::GFP::his-58::lpin-1 3'utr + unc-119(+)] No GFP expression detected in germline. Mutagen: Bombardment Outcrossed: x Reference: Made by: Orna Cohen-Fix Received: 07/02/09 from Cohen-Fix O, NIH, NIDDK, Bethesda, MD -------------------- Strain: AH12 Species: Caenorhabditis elegans Genotype: gap-1(ga133) X. Description: Null allele. Mutagen: Psoralen Outcrossed: x4 Reference: CGC #2916 Hajnal A;Whitfield CW;Kim SK Inhibition of Caenorhabditis elegans vulval induction by gap-1 and by let-23 receptor tyrosine kinase. Genes & Development 11: 2715-2728 1997 Made by: Alex Hajnal Received: 12/08/97 from Hajnal A, University of Zurich, Zurich, Switzerland -------------------- Strain: AH75 Species: Caenorhabditis elegans Genotype: apr-1(zh10) unc-29(e1072) I; zhEx11. Description: zhEx11[apr-1(+) + sur-5::GFP]. Unc. Segregates dead eggs that have lost the rescuing array. Mutagen: EMS Outcrossed: x6 Reference: CGC #3991 Hoier EF;Mohler WA;Kim SK;Hajnal A The Caenorhabditis elegans APC-related gene apr-1 is required for epithelial cell migration and Hox gene expression. Genes & Development 14: 874-886 2000 Made by: Alex Hajnal Received: 07/24/00 from Hajnal A, University of Zurich, Zurich, Switzerland -------------------- Strain: AH102 Species: Caenorhabditis elegans Genotype: lip-1(zh15) IV. Description: Deletion allele which removes exons 2 to 6 of lip-1 (C05B10.1). Incompletely penetrant ovulation defect. Mutagen: EMS Outcrossed: x8 Reference: CGC #4542 Berset T;Hoier EF;Battu G;Canevascini S;Hajnal A Notch inhibition of Ras signaling through MAP kinase phosphatase LIP-1 during C. elegans vulval development. Science 291: 1055-1058 2001 Made by: Thomas Berset Received: 05/21/01 from Hajnal A, University of Zurich, Zurich, Switzerland -------------------- Strain: AH142 Species: Caenorhabditis elegans Genotype: zhIs4[pTB10] III. Description: lip-1::GFP transcriptional reporter. lip-1::GFP expression is upregulated in the secondary VPCs P5.p and P7.p of early L3 animals. Mutagen: Gamma Rays Outcrossed: x5 Reference: CGC #4542 Berset T;Hoier EF;Battu G;Canevascini S;Hajnal A Notch inhibition of Ras signaling through MAP kinase phosphatase LIP-1 during C. elegans vulval development. Science 291: 1055-1058 2001 Made by: Thomas Berset Received: 05/21/01 from Hajnal A, University of Zurich, Zurich, Switzerland -------------------- Strain: AH159 Species: Caenorhabditis elegans Genotype: sra-13(zh13) II. Description: sra-13(zh13) mutants display stronger chemotaxis to limiting concentrations of isoamylalcohol and diacetyl than WT animals. Deletion allele. 396 bp of 5' promoter sequence and all but the last exon are removed; probably a null allele. Mutagen: EMS Outcrossed: x8 Reference: CGC #5965 Battu G;Hoier EF;Hajnal A The C. elegans G-protein-coupled receptor SRA-13 inhibits RAS/MAPK signalling during olfaction and vulval development. Development 130: 2567-2577 2003 Made by: Gopal Battu Received: 12/16/03 from Hajnal A, University of Zurich, Zurich, Switzerland -------------------- Strain: AH205 Species: Caenorhabditis elegans Genotype: sdn-1(zh20) X. Description: Slightly Unc. Variably Egl. zh20 is a deletion in sdn-1. The sequence of the breakpoint is: TTTGCTTCACAC//zh20//GTCGACAGGCAG. Mutagen: EMS Outcrossed: x6 Reference: Made by: Erika Frohli Received: 10/26/05 from Hajnal A, University of Zurich, Zurich, Switzerland -------------------- Strain: AH286 Species: Caenorhabditis elegans Genotype: unc-4(e120) ect-2(zh8) II; gap-1(ga133) X. Description: Muv and Unc. Semi-dominant mutation in ect-2 (previously called let-21). Mutagen: EMS Outcrossed: x3 Reference: Made by: Erika Frohli Received: 12/27/05 from Hajnal A, University of Zurich, Zurich, Switzerland -------------------- Strain: AH346 Species: Caenorhabditis elegans Genotype: dep-1(zh34) unc-4(e120) II; lip-1(zh15) IV. Description: Pvl and weak Muv. Transformation of secondary to primary vulval cell fates. Mutagen: Outcrossed: x Reference: Made by: Thomas Berset Received: 12/27/05 from Hajnal A, University of Zurich, Zurich, Switzerland -------------------- Strain: AM1 Species: Caenorhabditis elegans Genotype: osr-1(rm1) I. Description: Osmotic stress resistant. Received new stock May 7, 2008. Mutagen: EMS Outcrossed: x4 Reference: CGC #6587 Solomon A;Bandhakavi S;Jabbar S;Shah R;Beitel GJ;Morimoto RI Caenorhabditis elegans OSR-1 regulates behavioral and physiological responses to hyperosmotic environments. Genetics 187: 161-170 2004 Made by: Aharon Solomon Received: 10/14/04 from Morimoto R, Northwestern University, Evanston, IL -------------------- Strain: AM44 Species: Caenorhabditis elegans Genotype: rmIs190. Description: rmIs190 [F25B3.3p::Q67::CFP]. Pan-neuronal CFP expression. Mutagen: Gamma irradiation Outcrossed: x5 Reference: Made by: S Tang & H Brignull Received: 01/06/11 from Morimoto R, Northwestern University, Evanston, IL -------------------- Strain: AM49 Species: Caenorhabditis elegans Genotype: rmIs172. Description: rmIs172 [F25B3.3p::Q19::CFP]. Pan-neuronal CFP expression. Reference: Gidalevitz T, et al., Science. 2006 Mar 10;311(5766):1471-4. Mutagen: Gamma irradiation Outcrossed: x5 Reference: Made by: S Tang & H Brignull Received: 01/06/11 from Morimoto R, Northwestern University, Evanston, IL -------------------- Strain: AM101 Species: Caenorhabditis elegans Genotype: rmIs110. Description: rmIs110 [F25B3.3p::Q40::YFP]. Pan-neuronal YFP expression. Reference: Gidalevitz T, et al., Science. 2006 Mar 10;311(5766):1471-4. Mutagen: Gamma irradiation Outcrossed: x0 Reference: Made by: Heather Brignull Received: 01/06/11 from Morimoto R, Northwestern University, Evanston, IL -------------------- Strain: AM134 Species: Caenorhabditis elegans Genotype: rmIs126. Description: rmIs126[P(unc-54) Q0::YFP]. Diffuse distribution of Q0::YFP throughout the body-wall muscle cells. Mutagen: Gamma Rays Outcrossed: x5 Reference: CGC #6510 Nollen EAA;Garcia SM;van Haaften G;Kim S;Chavez A;Morimoto RI;Plasterk RHA Genome-wide RNA interference screen identifies previously undescribed regulators of polyglutamine aggregation. Proceedings of the National Academy of Sciences USA 101: 6403-6408 2004 Made by: S. Garcia/A Chavez Received: 04/05/05 from Morimoto R, Northwestern University, Evanston, IL -------------------- Strain: AM138 Species: Caenorhabditis elegans Genotype: rmIs130 II. Description: rmIs130[P(unc-54) Q24::YFP]. Diffuse distribution of Q24::YFP throughout the body-wall muscle cells. Mutagen: Gamma Rays Outcrossed: x5 Reference: CGC #6510 Nollen EAA;Garcia SM;van Haaften G;Kim S;Chavez A;Morimoto RI;Plasterk RHA Genome-wide RNA interference screen identifies previously undescribed regulators of polyglutamine aggregation. Proceedings of the National Academy of Sciences USA 101: 6403-6408 2004 Made by: S. Garcia Received: 04/05/05 from Morimoto R, Northwestern University, Evanston, IL -------------------- Strain: AM140 Species: Caenorhabditis elegans Genotype: rmIs132 I. Description: rmIs132[P(unc-54) Q35::YFP]. AM140 animals show a Q35::YFP progressive transition from soluble to aggregated as they age. Mutagen: Gamma Rays Outcrossed: x5 Reference: CGC #6510 Nollen EAA;Garcia SM;van Haaften G;Kim S;Chavez A;Morimoto RI;Plasterk RHA Genome-wide RNA interference screen identifies previously undescribed regulators of polyglutamine aggregation. Proceedings of the National Academy of Sciences USA 101: 6403-6408 2004 Made by: S. Garcia/A Chavez Received: 04/05/05 from Morimoto R, Northwestern University, Evanston, IL -------------------- Strain: AM141 Species: Caenorhabditis elegans Genotype: rmIs133. Description: rmIs133[P(unc-54) Q40::YFP]. AM141 animals show a soluble Q40::YFP distribution in body wall muscle cells immediately after hatching. As these worms age the rapid formation of foci is observed. When they reach adulthood, AM141 animals show an entirely Q40::YFP aggregated phenotype. Mutagen: Gamma Rays Outcrossed: x5 Reference: CGC #6510 Nollen EAA;Garcia SM;van Haaften G;Kim S;Chavez A;Morimoto RI;Plasterk RHA Genome-wide RNA interference screen identifies previously undescribed regulators of polyglutamine aggregation. Proceedings of the National Academy of Sciences USA 101: 6403-6408 2004 Made by: S. Garcia/A Chavez Received: 04/05/05 from Morimoto R, Northwestern University, Evanston, IL -------------------- Strain: AM263 Species: Caenorhabditis elegans Genotype: rmIs175. Description: rmIs175 [unc-54p::Hsa-sod-1 (WT)::YFP]. Array encodes wild-type human SOD-1. YFP expression in body wall muscle. Array is prone to silencing; maintain by picking worms displaying typical aggregation patterns. Reference: Gidalevitz T, et al., PLoS Genet. 2009 Mar;5(3):e1000399. Mutagen: Gamma irradiation Outcrossed: x5 Reference: Made by: Tom Krupinski Received: 01/06/11 from Morimoto R, Northwestern University, Evanston, IL -------------------- Strain: AM725 Species: Caenorhabditis elegans Genotype: rmIs290. Description: rmIs175 [unc-54p::Hsa-sod-1 (127X)::YFP]. Array encodes mutated form of human SOD-1. YFP expression in body wall muscle. Array is prone to silencing; maintain by picking worms displaying typical aggregation patterns. Reference: Gidalevitz T, et al., PLoS Genet. 2009 Mar;5(3):e1000399. Mutagen: Gamma irradiation Outcrossed: x5 Reference: Made by: Tom Krupinski Received: 01/06/11 from Morimoto R, Northwestern University, Evanston, IL -------------------- Strain: AN87 Species: Caenorhabditis elegans Genotype: sel-12(ty11) X. Description: Egl. Premature stop codon. Mutagen: EMS Outcrossed: x6 Reference: CGC #4859 Cinar HN;Sweet KL;Hosemann KE;Earley K;Newman AP The SEL-12 presenilin mediates induction of the Caenorhabditis elegans uterine pi cell fate. Developmental Biology 237: 173-182 2001 Made by: Nese Cinar Received: 12/04/01 from Newman A, Baylor College of Medicine, Houston, TX -------------------- Strain: AN170 Species: Caenorhabditis elegans Genotype: aff-1(ty4) unc-4(e120)/mnC1 dpy-10(e128) unc-52(e444) II. Description: Heterozygotes are WT and segregate WT, Unc-4 worms which are strong Egl, and paralyzed Dpy Uncs. Mutagen: EMS Outcrossed: x5 Reference: Made by: J Choi/A Newman Received: 02/19/08 from Baird S, Wright State University, Dayton, OH -------------------- Strain: AP36 Species: Caenorhabditis elegans Genotype: mep-1(ok421)/nT1[qIs51](IV;V). Description: Heterozygotes are WT and GFP+ and segregate 1/4 dead eggs (qIs51 homozygotes), 1/4 Mep hermaphrodites and dead eggs. Received new stock 12/02. Mutagen: UV/TMP Outcrossed: x5 Reference: CGC #5338 Belfiore M;Mathies LD;Pugnale P;Moulder G;Barstead R;Kimble J;Puoti A The MEP-1 zinc-finger protein acts with MOG DEAH box proteins to control gene expression via the fem-3 3'-untranslated region in Caenorhabditis elegans. RNA 8: 725-739 2002 Made by: A Puoti Received: 08/14/02 from Puoti A, University of Fribourg, Switzerland -------------------- Strain: AQ866 Species: Caenorhabditis elegans Genotype: ser-4(ok512) III. Description: Y22D7AR.13. Hyperactive 5HT induced egglaying. Homozygous. Outer Left Sequence: AATTATCGGATTTAGGGCCG. Outer Right Sequence: ATGGAACGGAGCATTATTCG. Inner Left Sequence: CAACACGCAACGAATGTACC. Inner Right Sequence: TGTGAAGTTTGGGAGGCTTT. Inner primer WT PCR product: 3126. Outcrossed 5 times by Stanley Shyn. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: UV/TMP Outcrossed: x5 Reference: Made by: Stanley Shyn Received: 02/24/03 from Schafer B, MRC-LMB, Cambridge, England -------------------- Strain: AR1 Species: Caenorhabditis elegans Genotype: hcp-6(mr17) I. Description: 15C: no phenotype. 26C: shifted as L4 or later results in 100% embryonic lethality; shifted before L4 results in Unc and Sterile animals. Intermediate phenotypes between 20-23C. Mutagen: EMS Outcrossed: x5 Reference: CGC #5322 Stear JH;Roth MB Characterization of HCP-6, a C. elegans protein required to prevent chromosome twisting and merotelic attachment. Genes & Development 16: 1498-1508 2002 Made by: Roth/Morrison/Stear Received: 11/04/02 from Roth M, Fred Hutchinson Cancer Research Center, Seattle, WA -------------------- Strain: AR2 Species: Caenorhabditis elegans Genotype: hcp-6(mr17) unc-73(e936) I. Description: Unc at all temperatures. For hcp-6: 15C: no phenotype. 26C: shifted as L4 or later results in 100% embryonic lethality; shifted before L4 results in Unc and Sterile animals. Intermediate phenotypes between 20-23C. Mutagen: Outcrossed: x Reference: CGC #5322 Stear JH;Roth MB Characterization of HCP-6, a C. elegans protein required to prevent chromosome twisting and merotelic attachment. Genes & Development 16: 1498-1508 2002 Made by: Jeff Stear Received: 11/04/02 from Roth M, Fred Hutchinson Cancer Research Center, Seattle, WA -------------------- Strain: AS270 Species: Caenorhabditis elegans Genotype: gly-12(id47) X. Description: Phenotypically WT. F3.2 See also WBPaper00005927. Mutagen: UV/TMP Outcrossed: x5 Reference: CGC #5572 Chen S;Tan J;Reinhold VN;Spence AM:Schachter H UDP-N-acetylglucosamine: alpha-3-D-mannoside beta-1,2-N-acetylglucosaminyltransferase I and UDP-N-acetylglucosamine: alpha-6-D-mannoside beta-1,2-N-acetylglucosaminyltransferase II in Caenorhabditis e Biochimica et Biophysica Acta 1573: 271-279 2002 Made by: Received: 03/12/03 from Schachter H, Hospital for Sick Children, Toronto, Ontario, Canada -------------------- Strain: AS271 Species: Caenorhabditis elegans Genotype: gly-14(id48) III. Description: Phenotypically WT. M8ns. See also WBPaper00005927. Mutagen: UV/TMP Outcrossed: x5 Reference: CGC #5572 Chen S;Tan J;Reinhold VN;Spence AM:Schachter H UDP-N-acetylglucosamine: alpha-3-D-mannoside beta-1,2-N-acetylglucosaminyltransferase I and UDP-N-acetylglucosamine: alpha-6-D-mannoside beta-1,2-N-acetylglucosaminyltransferase II in Caenorhabditis e Biochimica et Biophysica Acta 1573: 271-279 2002 Made by: Received: 03/12/03 from Schachter H, Hospital for Sick Children, Toronto, Ontario, Canada -------------------- Strain: AS338 Species: Caenorhabditis elegans Genotype: dpy-6(e14) gly-13(ok712) X. Description: Mutagen: UV/TMP Outcrossed: x5 Reference: CGC #6851 Zhu S;Hanneman A;Reinhold VN;Spence AM;Schachter H Caenorhabditis elegans triple null mutant lacking UDP-N-acetyl-D-glucosamine: alpha-3-D-mannoside beta1,2-N-acetylglucosaminyltransferase I. Biochemical Journal 382: 995-1001 2004 Made by: Harry Schachter Received: 01/24/04 from Schachter H, Hospital for Sick Children, Toronto, Ontario, Canada -------------------- Strain: AT6 Species: Caenorhabditis elegans Genotype: srf-2(yj262)I. Description: WT. Antibody staining required to observe phenotype. Mutagen: EMS Outcrossed: x Reference: CGC #1280 Politz SM;Philipp M;Estevez M;O'Brien PJ;Chin KJ Genes that can be mutated to unmask hidden antigenic determinants in the cuticle of the nematode Caenorhabditis elegans. Proceedings of the National Academy of Sciences USA 87: 2901-2905 1990 Made by: Miguel Estevez Received: 06/18/90 from Politz S, Worcester Polytechnic Institute, Worcester, MA -------------------- Strain: AT10 Species: Caenorhabditis elegans Genotype: srf-3(yj10) IV. Description: WT. Antibody staining required to observe phenotype. Contains at least one extraneous mutation in the background (Eur. Worm Mtg 2006, Venuz et al.). Mutagen: Outcrossed: x Reference: CGC #1280 Politz SM;Philipp M;Estevez M;O'Brien PJ;Chin KJ Genes that can be mutated to unmask hidden antigenic determinants in the cuticle of the nematode Caenorhabditis elegans. Proceedings of the National Academy of Sciences USA 87: 2901-2905 1990 Made by: Received: 06/18/90 from Politz S, Worcester Polytechnic Institute, Worcester, MA -------------------- Strain: AU1 Species: Caenorhabditis elegans Genotype: sek-1(ag1) X. Description: Enhanced susceptibility to pathogens (esp). Egl-d. Nsy. Also called esp-2. Mutagen: EMS Outcrossed: x3 Reference: CGC #5370 Kim DH;Feinbaum R;Alloing G;Emerson FE;Garsin DA;Inoue H;Tanaka-Hino M;Hisamoto N;Matsumoto K;Tan MW;Ausubel FM A conserved p38 MAP kinase pathway in Caenorhabditis elegans innate immunity. Science 297: 623-626 2002 Made by: R. Feinbaum Received: 02/26/03 from Ausubel F, Massachusetts General Hospital, Boston, MA -------------------- Strain: AU3 Species: Caenorhabditis elegans Genotype: nsy-1(ag3) II. Description: Enhanced susceptibility to pathogens (esp). Nsy. Egl-d. Also called esp-8. Mutagen: EMS Outcrossed: x3 Reference: CGC #5370 Kim DH;Feinbaum R;Alloing G;Emerson FE;Garsin DA;Inoue H;Tanaka-Hino M;Hisamoto N;Matsumoto K;Tan MW;Ausubel FM A conserved p38 MAP kinase pathway in Caenorhabditis elegans innate immunity. Science 297: 623-626 2002 Made by: G. Alloing Received: 02/26/03 from Ausubel F, Massachusetts General Hospital, Boston, MA -------------------- Strain: AU37 Species: Caenorhabditis elegans Genotype: glp-4(bn2) I; sek-1(km4) X. Description: Temperature sensitive sterility. Maintain at 15C. Enhanced sensitivity to pathogens. Mutagen: Outcrossed: x Reference: Made by: Terence Moy Received: 04/16/08 from Ausubel F, Massachusetts General Hospital, Boston, MA -------------------- Strain: AU98 Species: Caenorhabditis elegans Genotype: inx-14(ag17) I. Description: Enhanced pathogen resistance. Mutagen: EMS Outcrossed: x5 Reference: Made by: Sachiko Miyata Received: 04/16/08 from Ausubel F, Massachusetts General Hospital, Boston, MA -------------------- Strain: AU147 Species: Caenorhabditis elegans Genotype: daf-16(mgDf47) I; glp-1(e2141) III. Description: Temperature sensitive sterility. Maintain at 15C. Mutagen: Outcrossed: x Reference: Made by: Sachiko Miyata Received: 04/16/08 from Ausubel F, Massachusetts General Hospital, Boston, MA -------------------- Strain: AU166 Species: Caenorhabditis elegans Genotype: daf-16(mgDf47) I; fog-2(q71) V. Description: Temperature sensitive. Maintain at 15C. Mutagen: Outcrossed: x Reference: Made by: Sachiko Miyata Received: 05/19/08 from Ausubel F, Massachusetts General Hospital, Boston, MA -------------------- Strain: AV38 Species: Caenorhabditis elegans Genotype: mnDp66 (X;I); meDf2 X. Description: Produces 31% XO male self progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf2 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf2/+ heterozygotes produce 4-6% XO progeny, so the presence of the Df can be followed in heterozygotes by following this weak Him phenotype. Mutagen: Gamma Rays Outcrossed: x2 Reference: CGC #1924 Villeneuve AM A cis-acting locus that promotes crossing over between X chromosomes in Caenorhabditis elegans. Genetics 136: 887-902 1994 Made by: Anne Villeneuve Received: 06/16/97 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV39 Species: Caenorhabditis elegans Genotype: mnDp66 (X;I); meDf3 X. Description: Produces 32% XO male self progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf3 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf3/+ heterozygotes produce 4-6% XO progeny, so the presence of the Df can be followed in heterozygotes by following this weak Him phenotype. Mutagen: Gamma Rays Outcrossed: x2 Reference: CGC #1924 Villeneuve AM A cis-acting locus that promotes crossing over between X chromosomes in Caenorhabditis elegans. Genetics 136: 887-902 1994 Made by: Anne Villeneuve Received: 06/16/97 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV40 Species: Caenorhabditis elegans Genotype: mnDp66 (X;I); meDf4 X. Description: Produces 27% XO male self progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf4 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf4/+ heterozygotes produce 4-6% XO progeny, so the presence of the Df can be followed in heterozygotes by following this weak Him phenotype. Mutagen: Gamma Rays Outcrossed: x2 Reference: CGC #1924 Villeneuve AM A cis-acting locus that promotes crossing over between X chromosomes in Caenorhabditis elegans. Genetics 136: 887-902 1994 Made by: Anne Villeneuve Received: 06/16/97 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV41 Species: Caenorhabditis elegans Genotype: mnDp66 (X;I); meDf5 X. Description: Produces 32% XO male self-progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf5 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf5/+ heterozygotes produce 4-6% XO progeny, so the presence of the Df can be followed in heterozygotes by following this weak Him phenotype. Mutagen: Gamma Rays Outcrossed: x2 Reference: CGC #1924 Villeneuve AM A cis-acting locus that promotes crossing over between X chromosomes in Caenorhabditis elegans. Genetics 136: 887-902 1994 Made by: Anne Villeneuve Received: 06/16/97 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV51 Species: Caenorhabditis elegans Genotype: me8 X. Description: Homozygotes produce 10-15% XO males self progeny; nondisjuction is correlated with an increased frequency of achiasmate X chromosomes in oocyte nuclei, and an unaltered distribution of X chromosome crossovers. Heterozygotes produce 1-2% male self-progeny. Homozygotes (and XO hemizygotes) are slower growing than WT; reduced male mating efficiency. Disrupts the function ofthe cis-acting X chromosome meiotic pairing center. Molecular studies show that the me8 chromosome carries a terminal deletion that removes >70 kb from the left end of the X chromosome, including the endogenous telomere; further, a segment of chromosome V has been translocated to the left end of X, and a new telomere has been added de novo to the end of the translocated segment. Mutagen: EMS Outcrossed: x4 Reference: CGC #1924 Villeneuve AM A cis-acting locus that promotes crossing over between X chromosomes in Caenorhabditis elegans. Genetics 136: 887-902 1994 Made by: Anne Villeneuve Received: 06/16/97 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV106 Species: Caenorhabditis elegans Genotype: spo-11(ok79) IV/nT1[unc-?(n754) let-?](IV;V). Description: Heterozygotes are Unc and segregate Uncs, dead eggs and WT. The WT (spo-11 homozygotes) produce about 200 fertilized eggs but only about 0.1 progeny that survive to adulthood. When mated to N2 males, spo-11 homozygotes will produce at least 5-10 cross progeny. Mutagen: Diepoxybutane Outcrossed: x8 Reference: CGC #3166 Dernburg AF;McDonald K;Moulder G;Barstead R;Dresser M;Villeneuve AM Meiotic recombination in C. elegans initiates by a conserved mechanism and is dispensable for homologous chromosome synapsis. Cell 94: 387-398 1998 Made by: Abby Dernburg Received: 10/30/98 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV112 Species: Caenorhabditis elegans Genotype: mre-11(ok179) IV/nT1[unc-?(n754) let-?] (IV;V). Description: Heterozygotes are Unc. mre-11 homozygotes produce about 200 fertilized eggs but only about 2-3% of these eggs survive to adulthood (this mutation cannot be maintained in a homozygous condition). Occasionally non-Unc progeny that do not demonstrate the mre-11(ok179) mutant phenotype arise when grown in large liquid cultures. mre-11 is the predict gene ZC302.1 Mutagen: Outcrossed: x Reference: CGC #4377 Kelly KO;Dernburg AF;Stanfield GM;Villeneuve AM Caenorhabditis elegans msh-5 is required for both normal and radiation-induced meiotic crossing-over but not for completion of meiosis. Genetics 156: 617-630 2000 Made by: Deletion Consortium Received: 12/04/00 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV115 Species: Caenorhabditis elegans Genotype: msh-5(me23) IV/nT1[unc-?(n754) let-?] (IV;V). Description: Heterozygotes are Unc and segregate Uncs, dead eggs, and non-Uncs which give 97.9% dead eggs (of those that hatch, 42% are male). Mutagen: EMS Outcrossed: x Reference: CGC #4377 Kelly KO;Dernburg AF;Stanfield GM;Villeneuve AM Caenorhabditis elegans msh-5 is required for both normal and radiation-induced meiotic crossing-over but not for completion of meiosis. Genetics 156: 617-630 2000 Made by: Received: 03/06/02 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV125 Species: Caenorhabditis elegans Genotype: spe-8(hc40) I; dpy-4(e1166) IV. Description: Can be maintained by chunking or setting up male/hermaphrodite crosses. Dpy. Mutagen: Outcrossed: x Reference: Made by: Gillian Stanfield Received: 10/30/06 from Stanfield G, University of Utah, Salt Lake City, UT -------------------- Strain: AV146 Species: Caenorhabditis elegans Genotype: chk-2(me64) rol-9(sc148)/unc-51(e369) rol-9(sc148) V. Description: Heterozygotes are Rollers and segregate Rollers, Unc Rollers, and Rollers which give 96-97% dead eggs (among the survivors are a high % of males). Mutagen: Outcrossed: x Reference: CGC #4767 MacQueen AJ;Villeneuve AM Nuclear reorganization and homologous chromosome pairing during meiotic prophase require C. elegans chk-2. Genes & Development 15: 1674-1687 2001 Made by: Amy MacQueen Received: 07/11/01 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV157 Species: Caenorhabditis elegans Genotype: spo-11(me44)/nT1[unc-?(n754) let-? qIs50](IV;V). Description: Heterozygotes are Unc. spo-11(me44) homozygotes are viable and non-Unc. They produce more than 90% dead eggs and a large fraction of the survivors are males (strong Him phenotype). Cytologically they lack chiasmata in diakinesis-stage oocytes and lack RAD-51 foci. Maintain by picking Unc. Mutagen: EMS Outcrossed: x>2 Reference: Made by: Gregory Chin Received: 08/27/07 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV158 Species: Caenorhabditis elegans Genotype: rad-50(ok197)/nT1[unc-?(n754) let-? qIs50](IV;V). Description: Heterozygotes are Unc and GFP+. rad-50(ok197) homozygotes are viable, non-Uncs. They produce 98.8% dead eggs and a large fraction of survivors are males (strong Him phenotype); cytologically they lack chiasmata in diakinesis-stage oocytes, but pairing and synapsis appear normal. Mutagen: Outcrossed: x4 Reference: Made by: Gregory Chin Received: 08/02/05 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV267 Species: Caenorhabditis elegans Genotype: syp-3(me42)/hT2[bli-4(e937) let-?(q782) qIs48](I;III). Description: Heterozygotes are WT and GFP+. Segregate syp-3(me42) homozygotes that are non-GFP and lay mostly dead eggs; these mutants form abnormal synaptonemal complex formation during meiosis. Homozygous hT2[bli-4 let-? qIs48] animals are inviable. Mutagen: EMS Outcrossed: x4 Reference: Made by: J Engebrecht Received: 09/28/07 from Colaiacovo M, Harvard Medical School, Boston, MA -------------------- Strain: AV271 Species: Caenorhabditis elegans Genotype: him-3(me80)/nT1[unc-?(n754) let-? qIs50](IV;V). Description: Heterozygotes are Unc. him-3(me80) homozygotes are viable and non-Unc. They produce more than 85% dead eggs and a large fraction (11%) of the survivors are males (Him phenotype). Cytologically they exhibit a reduced level of HIM-3 loading and fewer stretches of SYP-1 than WT. In diakinesis-stage oocytes, they contain a mixture of bivalents and univalents. Maintain by picking Unc. Mutagen: EMS Outcrossed: x>2 Reference: Made by: Kentaro Nabeshima Received: 08/27/07 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV276 Species: Caenorhabditis elegans Genotype: syp-2(ok307) V/nT1[unc-?(n754) let-?(m435)] (IV;V). Description: Heterozygotes are Unc. syp-2(ok307) homozygotes are viable, non-Unc. They produce 96% dead eggs and 44% males; cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes. Mutagen: UV/TMP Outcrossed: x6 Reference: CGC #6086 Colaiacovo MP;MacQueen AJ;Martinez-Perez E;McDonald K;Adamo A;La Volpe A;Villeneuve AM Synaptonemal complex assembly in C. elegans is dispensable for loading strand-exchange proteins but critical for proper completion of recombination. Developmental Cell 5: 463-474 2003 Made by: Monica Colaiacovo Received: 09/16/04 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV280 Species: Caenorhabditis elegans Genotype: unc-119(e2498) III; him-17(ok424) V; meIs5. Description: meIs5[unc-119(+) + him-17::GFP]. HIM-17::GFP is expressed in the germline. meIs5 not mapped. Mutagen: microparticle bombardment Outcrossed: x Reference: CGC #6740 Reddy KC;Villeneuve AM C. elegans HIM-17 links chromatin modification and competence for initiation of meiotic recombination. Cell 118: 439-452 2004 Made by: Kirthi Reddy Received: 09/16/04 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV285 Species: Caenorhabditis elegans Genotype: swm-1(me66) him-5(e1490) V. Description: Sperm activation in virgin males. Poor sperm transfer. Mutagen: EMS Outcrossed: x6 Reference: Made by: Gillian Stanfield Received: 05/25/06 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV307 Species: Caenorhabditis elegans Genotype: syp-1(me17) V/nT1[unc-?(n754) let-? qIs50] (IV;V). Description: Heterozygotes are Unc and GFP+. Segregates syp-1(me17) homozygotes which are viable, non-Unc, non-GFP; they produce 95% dead embryos and 38% males. Cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes. qIs50 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter (F22B7.9) driving GFP in the intestine. Mutagen: EMS Outcrossed: x>2 Reference: CGC #5462 MacQueen AJ;Colaiacovo MP;McDonald K;Villeneuve AM Synapsis-dependent and -independent mechanisms stabilize homolog pairing during meiotic prophase in C. elegans. Genes & Development 16: 2428-2442 2002 Made by: Amy MacQueen Received: 09/25/03 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV308 Species: Caenorhabditis elegans Genotype: him-14(it21)/mnC1 dpy-10(e128) unc-52(e444) II. Description: Heterozygotes are wild type and segregate wild type, DpyUncs, and him-14 homozygotes which are viable but produce >95% dead embryos and 45% males. Among these surviving progeny, cytologically they have 12 univalents in diakinesis-stage oocytes owing to a failure to form crossovers during meiosis. Mutagen: EMS Outcrossed: x Reference: CGC #3779 Zalevsky J;MacQueen AJ;Duffy JB;Kemphues KJ;Villeneuve AM Crossing over during Caenorhabditis elegans meiosis requires a conserved MutS-based pathway that is partially dispensable in budding yeast. Genetics 153: 1271-1283 1999 Made by: Received: 11/04/05 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV311 Species: Caenorhabditis elegans Genotype: dpy-18(e364) unc-3(e151) meT7 (III;X;IV). Description: Dpy. Unc. meT7 is an end-to-end-to-end fusion of chromosomes III, X, and V. The right end of III is fused to the left end of X, and the right end of X is fused to the left end of IV. Constructed by crossing eT5 and mnT12. meT7 homozygotes produce 92% viable progeny. meT7 heterozygotes are Him and produce many dead eggs. Mutagen: Outcrossed: x>1 Reference: CGC #6115 Hillers KJ;Villeneuve AM Chromosome-wide control of meiotic crossing over in C. elegans. Current Biology 13: 1641-1647 2003 Made by: Kenneth Hillers Received: 12/05/03 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AV322 Species: Caenorhabditis elegans Genotype: swm-1(me87) him-5(e1490) V. Description: Sperm activation in virgin males. Very poor sperm transfer. Mutagen: EMS Outcrossed: x6 Reference: Made by: Gillian Stanfield Received: 05/25/06 from Villeneuve A, Stanford University Medical School, Stanford, CA -------------------- Strain: AX1295 Species: Caenorhabditis elegans Genotype: gcy-35(ok769) I. Description: Supresses aggregation and bordering phenotypes of npr-1(null) animals. Mutagen: UV/TMP Outcrossed: x5 Reference: CGC #6624 Cheung BHH;Arellano-Carbajal F;Rybicki I;de Bono M Soluble guanylate cyclases act in neurons exposed to the body fluid to promote C. elegans aggregation behavior. Current Biology 14: 1105-1111 2004 Made by: Mario de Bono Received: 12/07/04 from de Bono M, MRC-LMB, Cambridge, England -------------------- Strain: AX1296 Species: Caenorhabditis elegans Genotype: gcy-36(db42) X. Description: Supresses aggregation and bordering phenotypes of npr-1(null) animals. Mutagen: EMS Outcrossed: x8 Reference: CGC #6624 Cheung BHH;Arellano-Carbajal F;Rybicki I;de Bono M Soluble guanylate cyclases act in neurons exposed to the body fluid to promote C. elegans aggregation behavior. Current Biology 14: 1105-1111 2004 Made by: Mario de Bono Received: 12/07/04 from de Bono M, MRC-LMB, Cambridge, England -------------------- Strain: AX1297 Species: Caenorhabditis elegans Genotype: gcy-36(db66) X. Description: Supresses aggregation and bordering phenotypes of npr-1(null) animals. Mutagen: EMS Outcrossed: x8 Reference: CGC #6624 Cheung BHH;Arellano-Carbajal F;Rybicki I;de Bono M Soluble guanylate cyclases act in neurons exposed to the body fluid to promote C. elegans aggregation behavior. Current Biology 14: 1105-1111 2004 Made by: Mario de Bono Received: 12/07/04 from de Bono M, MRC-LMB, Cambridge, England -------------------- Strain: AX1305 Species: Caenorhabditis elegans Genotype: gcy-34(ok1012) V; npr-1(ad609) X. Description: Does not supress aggregation and bordering phenotypes of npr-1(null) animals. Mutagen: Outcrossed: x Reference: CGC #6244 Page AP;Winter AD Enzymes involved in the biogenesis of the nematode cuticle. Advances in Parasitology 53: 85-148 2003 Made by: Mario de Bono Received: 12/07/04 from de Bono M, MRC-LMB, Cambridge, England -------------------- Strain: AY1 Species: Caenorhabditis elegans Genotype: nol-6(ac1) II. Description: Temperature sensitive mutant. Grow at 15 to 20C. Sterile at 25C. Mutagen: EMS Outcrossed: x4 Reference: Made by: Alejandro Aballay Received: 10/06/09 from Aballay A, Duke University, Durham, NC -------------------- Strain: AY101 Species: Caenorhabditis elegans Genotype: acIs101. Description: acIs101 [F35E12.5p::GFP + rol-6(su1006)]. Rollers. Reference: (2010) J Bio Chem 285(14):10832-40. Mutagen: Outcrossed: x4 Reference: Made by: Devin Bolz Received: 04/06/10 from Aballay A, Duke University, Durham, NC -------------------- Strain: AY102 Species: Caenorhabditis elegans Genotype: pmk-1(km25) IV; acEx102. Description: acEx102 [vha-6p::pmk-1::GFP + rol-6(su1006)]. Maintain by picking Rollers. Reference: (2010) J Bio Chem 285(14):10832-40. Mutagen: Outcrossed: x0 Reference: Made by: Devin Bolz Received: 04/06/10 from Aballay A, Duke University, Durham, NC -------------------- Strain: AZ30 Species: Caenorhabditis elegans Genotype: sma-1(ru18) V. Description: Strong Sma phenotype. Null allele. Mutagen: UV/Psoralen Outcrossed: x3 Reference: CGC #3094 McKeown C;Praitis V;Austin J sma-1 encodes a B(H)-spectrin homolog required for Caenorhabditis elegans morphogenesis. Development 125: 2087-2098 1998 Made by: Vida Praitis Received: 05/07/01 from Austin J, University of Chicago, IL -------------------- Strain: AZ212 Species: Caenorhabditis elegans Genotype: unc-119(ed3) ruIs32 III. Description: ruIs32 [pie-1::GFP::H2B + unc-119(+)]. Homozygous expression of GFP::H2B histone fusion in germline. pAZ132. Mutagen: microparticle bombardment Outcrossed: x0 Reference: CGC #4545 Praitis V;Casey E;Collar D;Austin J Creation of low-copy integrated transgenic lines in Caenorhabditis elegans. Genetics 157: 1217-1226 2001 Made by: Vida Praitis Received: 05/07/01 from Austin J, University of Chicago, IL -------------------- Strain: AZ217 Species: Caenorhabditis elegans Genotype: unc-119(ed3) ruIs37 III. Description: ruIs37 [myo-2p::GFP + unc-119(+)] III. Expresses GFP in the pharynx. pAZ119. Mutagen: Microparticle bombardment Outcrossed: x0 Reference: CGC #4545 Praitis V;Casey E;Collar D;Austin J Creation of low-copy integrated transgenic lines in Caenorhabditis elegans. Genetics 157: 1217-1226 2001 Made by: Vida Praitis Received: 05/17/01 from Austin J, University of Chicago, IL -------------------- Strain: AZ218 Species: Caenorhabditis elegans Genotype: unc-119(ed3) ruIs38 III. Description: ruIs38 [partial myo-2 promoter::GFP + unc-119(+)]. Expresses GFP in the pharynx. pAZ119. Mutagen: Microparticle bombardment Outcrossed: x0 Reference: CGC #4545 Praitis V;Casey E;Collar D;Austin J Creation of low-copy integrated transgenic lines in Caenorhabditis elegans. Genetics 157: 1217-1226 2001 Made by: Vida Praitis Received: 05/17/01 from Austin J, University of Chicago, IL -------------------- Strain: AZ235 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; ruIs48. Description: ruIs48[pie-1::tubulin::GFP fusion + unc-119(+)]. Homozygous expression of GFP::tubulin fusion in germline and early embryos. Insertion unmapped. pAZ147. Mutagen: microparticle bombardment Outcrossed: x0 Reference: CGC #4545 Praitis V;Casey E;Collar D;Austin J Creation of low-copy integrated transgenic lines in Caenorhabditis elegans. Genetics 157: 1217-1226 2001 Made by: Vida Praitis Received: 05/07/01 from Austin J, University of Chicago, IL -------------------- Strain: AZ244 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; ruIs57. Description: ruIs57[pie-1::GFP::tubulin + unc-119(+)]. Homozygous expression of GFP::tubulin fusion in germline and early embryos. Insertion unmapped. pAZ147. Mutagen: microparticle bombardment Outcrossed: x0 Reference: CGC #4545 Praitis V;Casey E;Collar D;Austin J Creation of low-copy integrated transgenic lines in Caenorhabditis elegans. Genetics 157: 1217-1226 2001 Made by: Vida Praitis Received: 05/07/01 from Austin J, University of Chicago, IL -------------------- Strain: BA1 Species: Caenorhabditis elegans Genotype: fer-1(hc1)I. Description: Temperature sensitive. M-MATING+LOW TEMP ONLY. Recessive. Fertilization abnormal. Mutagen: EMS Outcrossed: x Reference: CGC #393 Ward S;Miwa J Characterization of temperature-sensitive, fertilization-defective mutants of the nematode C. elegans. Genetics 88: 285-303 1978 Made by: Ward S Received: 03/01/80 from Herman B, University of Minnesota, Minneapolis, MN -------------------- Strain: BA2 Species: Caenorhabditis elegans Genotype: fer-2(hc2)III. Description: Temperature sensitive. Maintain at 15C. Some growth at 20C. Does not grow at 25C. Recessive. Mutagen: EMS Outcrossed: x Reference: CGC #495 Argon Y;Ward S C. elegans fertilization-defective mutants with abnormal sperm. Genetics 96: 413-433 1980 Made by: Ward S Received: 03/01/80 from Herman B, University of Minnesota, Minneapolis, MN -------------------- Strain: BA3 Species: Caenorhabditis elegans Genotype: fer-3(hc3)II. Description: Temperature sensitive. Fertilization abnormal. Recessive. Mutagen: EMS Outcrossed: x Reference: CGC #495 Argon Y;Ward S C. elegans fertilization-defective mutants with abnormal sperm. Genetics 96: 413-433 1980 Made by: Ward S Received: 03/01/80 from Herman B, University of Minnesota, Minneapolis, MN -------------------- Strain: BA4 Species: Caenorhabditis elegans Genotype: fer-4(hc4)V. Description: Fertilization abnormal. Recessive. Temperature sensitive. Maintain at 15C. Some growth at 20C and 25.4 C. Mutagen: EMS Outcrossed: x Reference: CGC #495 Argon Y;Ward S C. elegans fertilization-defective mutants with abnormal sperm. Genetics 96: 413-433 1980 Made by: Ward S Received: 03/01/80 from Herman B, University of Minnesota, Minneapolis, MN -------------------- Strain: BA6 Species: Caenorhabditis elegans Genotype: fer-6(hc6)I. Description: Fertilization abnormal. Temperature sensitive. Recessive. Mutagen: EMS Outcrossed: x Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: Ward S Received: 03/01/80 from Herman B, University of Minnesota, Minneapolis, MN -------------------- Strain: BA14 Species: Caenorhabditis elegans Genotype: fer-14(hc14)X. Description: Temperature sensitive. 8% of total oocytes produced are fertilized and give rise to larvae at 16C. Almost completely sterile at 25C. Mutagen: EMS Outcrossed: x2 Reference: CGC #558 Roberts TM;Ward S Membrane flow during nematode spermiogenesis. Journal of Cell Biology 92: 113-120 1982 Made by: Tom Roberts Received: 11/01/84 from Ward S, University of Arizona, Tucson -------------------- Strain: BA15 Species: Caenorhabditis elegans Genotype: fer-15(hc15)II. Description: Temperature sensitive. Maintain at 15C. Mutagen: EMS Outcrossed: x2 Reference: CGC #558 Roberts TM;Ward S Membrane flow during nematode spermiogenesis. Journal of Cell Biology 92: 113-120 1982 Made by: Tom Roberts Received: 11/01/84 from Ward S, University of Arizona, Tucson -------------------- Strain: BA17 Species: Caenorhabditis elegans Genotype: fem-1(hc17)IV. Description: Temperature sensitive. Recessive. Feminization. Mutagen: EMS Outcrossed: x Reference: CGC #252 Nelson GA;Lew KK;Ward S Intersex, a temperature-sensitive mutant of the nematode C. elegans. Developmental Biology 66: 386-409 1978 Made by: Nelson G Received: 03/01/80 from Herman B, University of Minnesota, Minneapolis, MN -------------------- Strain: BA23 Species: Caenorhabditis elegans Genotype: fer-6(hc23)I. Description: Temperature sensitive. Fertilization abnormal. Recessive. Mutagen: EMS Outcrossed: x Reference: CGC #492 Emmons SW;Rosenzweig B;Hirsh D Arrangement of repeated sequences in the DNA of the nematode C. elegans. Journal of Molecular Biology 144: 481-500 1980 Made by: Ward S Received: 03/01/80 from Herman B, University of Minnesota, Minneapolis, MN -------------------- Strain: BA24 Species: Caenorhabditis elegans Genotype: fer-1(hc24)I. Description: Fertilization abnormal. Recessive. Leaky ts. Mutagen: EMS Outcrossed: x Reference: CGC #393 Ward S;Miwa J Characterization of temperature-sensitive, fertilization-defective mutants of the nematode C. elegans. Genetics 88: 285-303 1978 Made by: Ward S Received: 03/01/80 from Herman B, University of Minnesota, Minneapolis, MN -------------------- Strain: BA34 Species: Caenorhabditis elegans Genotype: fer-7(hc34)I. Description: Fertilization abnormal. Recessive. Temperature sensitive. Maintain at 15C. Very Leaky-grows at 20C and also somewhat at 25.4C and 25.8C. Mutagen: EMS Outcrossed: x Reference: CGC #495 Argon Y;Ward S C. elegans fertilization-defective mutants with abnormal sperm. Genetics 96: 413-433 1980 Made by: Ward S Received: 03/01/80 from Herman B, University of Minnesota, Minneapolis, MN -------------------- Strain: BA521 Species: Caenorhabditis elegans Genotype: fer-1(hc1) unc-29(e1072) I. Description: Temperature sensitive. Maintain at 15C. Unc. Mutagen: Outcrossed: x Reference: CGC #393 Ward S;Miwa J Characterization of temperature-sensitive, fertilization-defective mutants of the nematode C. elegans. Genetics 88: 285-303 1978 Made by: Received: 02/01/86 from Ward S, University of Arizona, Tucson -------------------- Strain: BA522 Species: Caenorhabditis elegans Genotype: fer-1(hc13) unc-29(e1072)I. Description: Temperature sensitive. Maintain at 15C. Unc. Mutagen: EMS Outcrossed: x Reference: CGC #393 Ward S;Miwa J Characterization of temperature-sensitive, fertilization-defective mutants of the nematode C. elegans. Genetics 88: 285-303 1978 Made by: Received: 02/01/86 from Ward S, University of Arizona, Tucson -------------------- Strain: BA524 Species: Caenorhabditis elegans Genotype: fer-1(hc1)I; him-5(e1490)V. Description: Temperature sensitive. Maintain at 15C. Throws males. Mutagen: Outcrossed: x Reference: CGC #393 Ward S;Miwa J Characterization of temperature-sensitive, fertilization-defective mutants of the nematode C. elegans. Genetics 88: 285-303 1978 Made by: Y. Argon Received: 11/01/84 from Ward S, University of Arizona, Tucson -------------------- Strain: BA547 Species: Caenorhabditis elegans Genotype: fer-2(hc2)III; him-5(e1490)V. Description: Fertile at 16c and 20C. Sterile at 25C-Produces some defective embryos and 0-5 progeny. Throws males. Mutagen: Outcrossed: x Reference: CGC #529 Ward S;Argon Y;Nelson GA Sperm morphogenesis in wild-type and fertilization-defective mutants of C. elegans. Journal of Cell Biology 91: 26-44 1981 Made by: Received: 11/01/84 from Ward S, University of Arizona, Tucson -------------------- Strain: BA562 Species: Caenorhabditis elegans Genotype: fer-4(hc4) him-5(e1490)V. Description: Temperature sensitive. Maintain at 15C. Produces about 30% males. Mutagen: Outcrossed: x Reference: CGC #529 Ward S;Argon Y;Nelson GA Sperm morphogenesis in wild-type and fertilization-defective mutants of C. elegans. Journal of Cell Biology 91: 26-44 1981 Made by: Steve L'Hernault Received: 11/01/84 from Ward S, University of Arizona, Tucson -------------------- Strain: BA585 Species: Caenorhabditis elegans Genotype: spe-10(hc104) unc-76(e911)V. Description: Unc. Temperature sensitive, maintain at 16C. Average progeny: at 16C= 7 +/- 5; at 25C= 0.1 +/- .1. Mutagen: EMS Outcrossed: x Reference: CGC #1174 Shakes DC;Ward S Mutations that disrupt the morphogenesis and localization of a sperm-specific organelle in Caenorhabditis elegans. Developmental Biology 134: 307-316 1989 Made by: Steve L'Hernault Received: 02/03/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA590 Species: Caenorhabditis elegans Genotype: spe-10(hc104) dpy-11(e224)V. Description: Dpy. Temperature sensitive, maintain at 16C. Average progeny at 16C= 7 +/- 5. At 25C, average progeny = 0.1 =/- .1. Mutagen: EMS Outcrossed: x Reference: CGC #1174 Shakes DC;Ward S Mutations that disrupt the morphogenesis and localization of a sperm-specific organelle in Caenorhabditis elegans. Developmental Biology 134: 307-316 1989 Made by: Steve L'Hernault Received: 02/03/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA606 Species: Caenorhabditis elegans Genotype: spe-6(hc49) unc-25(e156)III; eDp6(III;f). Description: Animals with the Duplication are WT. Animals without the Duplication are Unc and Sterile. Mutagen: EMS Outcrossed: x10 Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: Steve L'Hernault Received: 02/03/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA609 Species: Caenorhabditis elegans Genotype: spe-6(hc49) vab-7(e1562)III; eDp6(III;f). Description: Animals with the Duplications are WT. Animals which have lost the Duplication are Sterile and have an abnormal tail. Mutagen: EMS Outcrossed: x10 Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: Steve L'Hernault Received: 02/03/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA671 Species: Caenorhabditis elegans Genotype: spe-9(hc88)I. Description: Self-sterile at 25C. Maintain at 15C. Mutagen: EMS Outcrossed: x>2 Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: Diane Shakes Received: 11/01/94 from L'Hernault S, Emory University, Atlanta, GA -------------------- Strain: BA676 Species: Caenorhabditis elegans Genotype: spe-6(hc92) unc-32(e189)III; eDp6(III;f). Description: Unc. Animals which have lost the duplications are Sterile (as well as Unc). Mutagen: EMS Outcrossed: x15 Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: Diane Shakes Received: 01/11/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA708 Species: Caenorhabditis elegans Genotype: spe-9(hc52)I. Description: Mutagen: EMS Outcrossed: x Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: Received: 06/15/88 from L'Hernault S, Emory University, Atlanta, GA -------------------- Strain: BA709 Species: Caenorhabditis elegans Genotype: fer-1(hc80) unc-29(e1072)/sDf6 I. Description: Heterozygotes are WT and segregate WT, Sterile Uncs and L1 lethals (sDf6/sDf6). hc80 is a nonconditional sterile. hc80 sperm have short pseudopods. Mutagen: EMS Outcrossed: x>3 Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: Steve L'Hernault Received: 10/17/94 from Ward S, University of Arizona, Tucson -------------------- Strain: BA714 Species: Caenorhabditis elegans Genotype: sDf5/spe-4(hc78)I. Description: Heterozygotes are WT and segregate WT, Steriles and dead eggs. Mutagen: EMS Outcrossed: x Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: Steve L'Hernault Received: 06/15/88 from L'Hernault S, Emory University, Atlanta, GA -------------------- Strain: BA717 Species: Caenorhabditis elegans Genotype: spe-11(hc90)I; sDp2(I;f). Description: WT. Animals which have lost the Dup are sterile. Maintain by picking fertile animals which throw steriles. Mutagen: EMS Outcrossed: x Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: Received: 06/15/88 from L'Hernault S, Emory University, Atlanta, GA -------------------- Strain: BA744 Species: Caenorhabditis elegans Genotype: spe-10(hc104)V. Description: Temperature sensitive, maintain at 15C. Average progeny at 16C is 7 +/- 5. Average progeny at 25C is 0.1 +/- .1. Mutagen: EMS Outcrossed: x Reference: CGC #1174 Shakes DC;Ward S Mutations that disrupt the morphogenesis and localization of a sperm-specific organelle in Caenorhabditis elegans. Developmental Biology 134: 307-316 1989 Made by: Diane Shakes Received: 02/03/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA759 Species: Caenorhabditis elegans Genotype: hcDf1 IV; eEx25. Description: Animals with eEx25 are WT. Animals which have lost eEx25 are Twitchers and Sterile (occasionally produce young). Mutagen: Spontaneous in TR466 Outcrossed: x Reference: CGC #1748 L'Hernault SW;Benian GM;Emmons RB Genetic and molecular characterization of the Caenorhabditis elegans spermatogenesis-defective gene spe-17. Genetics 134: 769-780 1993 Made by: Steve L'Hernault Received: 11/01/94 from L'Hernault S, Emory University, Atlanta, GA -------------------- Strain: BA763 Species: Caenorhabditis elegans Genotype: spe-5(hc93)I; sDp2(I;f). Description: Mutagen: EMS Outcrossed: x Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: Received: 06/15/88 from L'Hernault S, Emory University, Atlanta, GA -------------------- Strain: BA782 Species: Caenorhabditis elegans Genotype: spe-10(hc104) him-5(e1490)V. Description: Temperature sensitive, maintain at 16C. Segregates males. Average progeny at 16C is 7 +/- 5. Average progeny at 25C is 0.1 +/- .1. Mutagen: EMS Outcrossed: x Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: Diane Shakes. Received: 02/03/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA783 Species: Caenorhabditis elegans Genotype: spe-12(hc76)I. Description: Hermaphrodites produce nonfunctional sperm and are fertilization defective. Self-fertility is <1% at 16C or 25C. Males are fertile. Mutagen: EMS Outcrossed: x Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: Steve L'Hernault Received: 06/15/88 from L'Hernault S, Emory University, Atlanta, GA -------------------- Strain: BA784 Species: Caenorhabditis elegans Genotype: spe-8(hc50) I. Description: Male-hermaphrodite mating strain. Males are fertile, hermaphrodites are sterile. Mutagen: Steve L'Hernault Outcrossed: x Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: EMS Received: 01/05/01 from Ward S, University of Arizona, Tucson -------------------- Strain: BA785 Species: Caenorhabditis elegans Genotype: spe-8(hc40)I. Description: Hermaphrodites produce nonfunctional, nonmotile sperm with uniformly aberrant pseudopods. Male sperm normal. Self-fertility is <1% at 16C or 25C. Maintain by mating. Mutagen: EMS Outcrossed: x Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: Received: 06/15/88 from L'Hernault S, Emory University, Atlanta, GA -------------------- Strain: BA786 Species: Caenorhabditis elegans Genotype: spe-8(hc53) I. Description: Male-hermaphrodite mating strain. Males are fertile, hermaphrodites are sterile. Mutagen: Steve L'Hernault Outcrossed: x Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: EMS Received: 01/05/01 from Ward S, University of Arizona, Tucson -------------------- Strain: BA793 Species: Caenorhabditis elegans Genotype: spe-26(hc138) dpy-13(e184)IV. Description: Temperature sensitive. Fertile at 16C. Sterile at 25C. Partially fertile at 20C. Spermatogenesis arrests at teh spermatocyte stage. Mutagen: EMS Outcrossed: x15 Reference: CGC #1643 Van Voorhies WA Production of sperm reduces nematode life-span. Nature 360: 456-458 1992 Made by: Jacob Varkey Received: 02/03/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA794 Species: Caenorhabditis elegans Genotype: spe-13(hc137)I. Description: Temperature sensitive. Maintain at 15C. Mutagen: EMS Outcrossed: x Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: Received: 06/15/88 from L'Hernault S, Emory University, Atlanta, GA -------------------- Strain: BA811 Species: Caenorhabditis elegans Genotype: sDf5/spe-4(hc78) unc-15(e73)I. Description: Heterozygotes are WT and segregate WT, Sterile Unc and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1612 L'Hernault SW;Arduengo PM Mutation of a putative sperm membrane protein in Caenorhabditis elegans prevents sperm differentiation but not its associated meiotic divisions. Journal of Cell Biology 119: 55-68 1992 Made by: Steve L'Hernault Received: 06/15/88 from L'Hernault S, Emory University, Atlanta, GA -------------------- Strain: BA819 Species: Caenorhabditis elegans Genotype: spe-11(hc77)I. Description: Temperature sensitive sterile. Paternal effect embryonic lethal. Permissive temp is 20C. Restrictive temp is 25C. Mutagen: Outcrossed: x>4 Reference: CGC #1075 L'Hernault SW;Shakes DC;Ward S Developmental genetics of chromosome I spermatogenesis-defective mutants in the nematode Caenorhabditis elegans. Genetics 120: 435-452 1988 Made by: Diane Shakes Received: 10/17/94 from Ward S, University of Arizona, Tucson -------------------- Strain: BA821 Species: Caenorhabditis elegans Genotype: spe-26(hc138)IV. Description: Fertile at 15C; Sterile at 25C; Partially fertile at 20C. Spermatogenesis arrests at the spermatocyte stage. Increases lifespan of males and hermaphrodites. Mutagen: EMS Outcrossed: x15 Reference: CGC #1643 Van Voorhies WA Production of sperm reduces nematode life-span. Nature 360: 456-458 1992 Made by: Jacob Varkey Received: 01/11/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA824 Species: Caenorhabditis elegans Genotype: spe-26(hc139) dpy-20(e1282)IV. Description: Temperature sensitive. Partially fertile at 16C (very few progeny). Sterile at 20C and 25C. Weak Dpy at 15C. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x15 Reference: Made by: Jacob Varkey Received: 02/03/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA825 Species: Caenorhabditis elegans Genotype: spe-26(hc140) dpy-20(e1282)/+ IV. Description: Heterozygotes are WT and segregate WT and DpySpe. The DpySpe are temperature sensitive. They are partially fertile at 16C (very few progeny), and sterile at 20C and 25C. Weak Dpy at 15C. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x15 Reference: Made by: Jacob Varkey Received: 02/03/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA836 Species: Caenorhabditis elegans Genotype: spe-26(it112) unc-22(e66)IV. Description: Twitcher. Fertile at 15C; Sterile at 25C; Partially fertile at 20C. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x10 Reference: CGC #1643 Van Voorhies WA Production of sperm reduces nematode life-span. Nature 360: 456-458 1992 Made by: Diane Shakes Received: 01/11/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA837 Species: Caenorhabditis elegans Genotype: spe-26(it112)IV. Description: Fertile at 15C; Sterile at 25C; Partially fertile at 20C. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x10 Reference: CGC #1643 Van Voorhies WA Production of sperm reduces nematode life-span. Nature 360: 456-458 1992 Made by: Diane Shakes Received: 01/11/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA838 Species: Caenorhabditis elegans Genotype: spe-26(hc140)IV. Description: Temperature sensitive. Partially fertile at 16C (very few progeny). Sterile at 20C and 25C. Weak Dpy at 15C. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x15 Reference: Made by: Jacob Varkey Received: 02/03/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA839 Species: Caenorhabditis elegans Genotype: spe-26(it118) unc-22(e66)IV. Description: Twitchers. Fertile at 15C; Sterile at 25C; Partially fertile at 20C. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x10 Reference: CGC #1643 Van Voorhies WA Production of sperm reduces nematode life-span. Nature 360: 456-458 1992 Made by: Diane Shakes Received: 01/11/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA840 Species: Caenorhabditis elegans Genotype: spe-26(hc139)IV. Description: Temperature sensitive. Few progeny at 16C. Sterile at 20C and 25C. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x15 Reference: Made by: Jacob Varkey Received: 02/03/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA843 Species: Caenorhabditis elegans Genotype: spe-26(it118)IV. Description: Temperature sensitive. Fertile at 16C. Sterile at 25C. Partially fertile at 20C. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x10 Reference: Made by: Diane Shakes Received: 02/03/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA883 Species: Caenorhabditis elegans Genotype: spe-12(hc152) I. Description: Maintain by mating. Mutagen: Outcrossed: x Reference: CGC #3531 Nance J;Minniti AN;Sadler C;Ward S spe-12 encodes a sperm cell surface protein that promotes spermiogenesis in Caenorhabditis elegans. Genetics 152: 209-220 1999 Made by: Received: 01/05/01 from Ward S, University of Arizona, Tucson -------------------- Strain: BA900 Species: Caenorhabditis elegans Genotype: spe-27(it110)IV. Description: Male/hermaphrodite mating strain. Hermaphrodites self-sterile at all temps, males fertile. Spermatids activate "normally" in TEA. In pronase they produce spikes but never form pseudopods. Similar to spe-12 and spe-8. Mutagen: EMS Outcrossed: x Reference: CGC #2446 Minniti AN;Sadler C;Ward S Genetic and molecular analysis of spe-27, a gene required for spermiogenesis in Caenorhabditis elegans hermaphrodites. Genetics 143: 213-223 1996 Made by: Diane Shakes Received: 08/16/96 from Ward S, University of Arizona, Tucson -------------------- Strain: BA901 Species: Caenorhabditis elegans Genotype: spe-27(it110) dpy-20(e1282)IV. Description: Temperature sensitive Dpy. Male/hermaphrodite mating strain. Hermaphrodites self-sterile at all temps; males fertile. Spermatids arrest with spikes in pronase; form normal pseudopods in TEA. Mutagen: Outcrossed: x Reference: CGC #2446 Minniti AN;Sadler C;Ward S Genetic and molecular analysis of spe-27, a gene required for spermiogenesis in Caenorhabditis elegans hermaphrodites. Genetics 143: 213-223 1996 Made by: Received: 08/16/96 from Ward S, University of Arizona, Tucson -------------------- Strain: BA925 Species: Caenorhabditis elegans Genotype: spe-26(hc138) dpy-20(e1282)IV. Description: Temperature sensitive. Fertile at 16C. Sterile at 25C. Partially fertile at 20C. Weak Dpy at 15C. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x15 Reference: Made by: Jacob Varkey Received: 02/03/93 from Ward S, University of Arizona, Tucson -------------------- Strain: BA947 Species: Caenorhabditis elegans Genotype: spe-27(hc161)IV. Description: Male/hermaphrodite mating strain. Hermaphrodites self-sterile at all temps; males fertile. Mutagen: EMS Outcrossed: x6 Reference: CGC #2446 Minniti AN;Sadler C;Ward S Genetic and molecular analysis of spe-27, a gene required for spermiogenesis in Caenorhabditis elegans hermaphrodites. Genetics 143: 213-223 1996 Made by: Alicia Minniti Received: 08/16/96 from Ward S, University of Arizona, Tucson -------------------- Strain: BA959 Species: Caenorhabditis elegans Genotype: spe-29(it127) dpy-20(e1282) IV. Description: Homozygous male/hermaphrodite line. Males are fertile. Hermaphrodites are sterile, but slightly leaky producing a few progeny (at 25C - ts not tested). In pronase, spermatids from males activate to form many long spikes, terminating at this stage. A very few (1-3 per worm) activate to form normal-looking, motile spermatozoons. Mutagen: Outcrossed: x Reference: CGC #4444 Nance J;Davis EB;Ward S spe-29 encodes a small predicted protein required for the initiation of sperm activation in Caenorhabditis elegans. Genetics 156: 1623-1633 2000 Made by: Received: 01/05/01 from Ward S, University of Arizona, Tucson -------------------- Strain: BA962 Species: Caenorhabditis elegans Genotype: spe-29(it127) IV. Description: Hermaphrodites are sterile; Males are fertile. Hermaphrodites lay oocytes (produce a few fertile eggs and many oocytes). Produce viable progeny when mated to males. Hermaphrodites produce 10X more self progeny at 20C (2.5/herm) than at either 16C or 25C. Mutagen: Outcrossed: x3 Reference: CGC #4444 Nance J;Davis EB;Ward S spe-29 encodes a small predicted protein required for the initiation of sperm activation in Caenorhabditis elegans. Genetics 156: 1623-1633 2000 Made by: Jeremy Nance Received: 01/05/01 from Ward S, University of Arizona, Tucson -------------------- Strain: BA963 Species: Caenorhabditis elegans Genotype: spe-27(it132)IV. Description: Temperature sensitive spe-27 allele. Hermaphrodites are sterile at 25C but produce 30-40 progeny/hermaphrodite at 16C. Males are fertile. Mutagen: EMS Outcrossed: x Reference: CGC #2446 Minniti AN;Sadler C;Ward S Genetic and molecular analysis of spe-27, a gene required for spermiogenesis in Caenorhabditis elegans hermaphrodites. Genetics 143: 213-223 1996 Made by: Received: 08/16/96 from Ward S, University of Arizona, Tucson -------------------- Strain: BA966 Species: Caenorhabditis elegans Genotype: spe-27(it132) unc-22(e66)IV. Description: Temperature sensitive spe-27 allele. Hermaphrodites sterile at 25C; hermaphrodites produce 30-40 progeny/hermaphrodite at 16C. Males cannot mate due to the unc-22 mutation. Maintain at 15C. Mutagen: Outcrossed: x Reference: CGC #2446 Minniti AN;Sadler C;Ward S Genetic and molecular analysis of spe-27, a gene required for spermiogenesis in Caenorhabditis elegans hermaphrodites. Genetics 143: 213-223 1996 Made by: Paul Muhlrad Received: 08/16/96 from Ward S, University of Arizona, Tucson -------------------- Strain: BA968 Species: Caenorhabditis elegans Genotype: spe-29(it127) unc-24(e138) IV. Description: Unc. Leaky sterile at 20C. Tighter at 16C and 25C. Mutagen: Outcrossed: x Reference: CGC #4444 Nance J;Davis EB;Ward S spe-29 encodes a small predicted protein required for the initiation of sperm activation in Caenorhabditis elegans. Genetics 156: 1623-1633 2000 Made by: Jeremy Nance Received: 01/05/01 from Ward S, University of Arizona, Tucson -------------------- Strain: BA969 Species: Caenorhabditis elegans Genotype: spe-6(hc163) III; spe-27(it132) dpy-20(e1282) IV. Description: Dpy. spe-6(hc163) is a recessive suppressor of spe-27(it132). spe-6(hc163) also suppresses spe-8, spe-12, spe-29 and other spe-27 alleles. Causes precocious spermatid activation. Fertile between 15-25C. Mutagen: EMS (hc163) Outcrossed: x5 Reference: CGC #5276 Muhlrad PJ;Ward S Spermiogenesis initiation in Caenorhabditis elegans involves a casein kinase 1 encoded by the spe-6 gene. Genetics 161: 143-155 2002 Made by: Paul Muhlrad Received: 07/29/03 from Ward S, University of Arizona, Tucson -------------------- Strain: BA970 Species: Caenorhabditis elegans Genotype: spe-6(hc163) III; spe-27(it132) unc-22(e66) IV. Description: Twitcher Unc. spe-6(hc163) is a recessive suppressor of spe-27(it132). spe-6(hc163) also suppresses spe-8, spe-12, spe-29 and other spe-27 alleles. Causes precocious spermatid activation. Fertile between 15-25C. Mutagen: EMS (hc163) Outcrossed: x4 Reference: CGC #5276 Muhlrad PJ;Ward S Spermiogenesis initiation in Caenorhabditis elegans involves a casein kinase 1 encoded by the spe-6 gene. Genetics 161: 143-155 2002 Made by: Paul Muhlrad Received: 07/29/03 from Ward S, University of Arizona, Tucson -------------------- Strain: BA971 Species: Caenorhabditis elegans Genotype: spe-27(it132) dpy-20(e1282)IV. Description: Temperature sensitive spe-27 allele. Leaky sterile at 20C. Males at 20C produce spermatids that form spikes in pronase. Males are fertile. Temperature sensitive dpy-20 allele. Maintain at 15C. Mutagen: Outcrossed: x Reference: CGC #2446 Minniti AN;Sadler C;Ward S Genetic and molecular analysis of spe-27, a gene required for spermiogenesis in Caenorhabditis elegans hermaphrodites. Genetics 143: 213-223 1996 Made by: Received: 08/16/96 from Ward S, University of Arizona, Tucson -------------------- Strain: BA975 Species: Caenorhabditis elegans Genotype: spe-6(hc163) III; spe-29(it127) dpy-20(e1282) IV. Description: spe-6(hc163) suppresses the self-sterility of spe-29 in this strain. Self-sterile at 25C. Mutagen: Outcrossed: x Reference: CGC #5276 Muhlrad PJ;Ward S Spermiogenesis initiation in Caenorhabditis elegans involves a casein kinase 1 encoded by the spe-6 gene. Genetics 161: 143-155 2002 Made by: Paul Muhlrad Received: 02/28/05 from Ward S, University of Arizona, Tucson -------------------- Strain: BA979 Species: Caenorhabditis elegans Genotype: dpy-5(e61) spe-12(hc76) I; spe-6(hc163) III. Description: spe-6(hc163) suppresses hermaphrodite self-sterility of hc76. Dpy. Mutagen: Outcrossed: x Reference: CGC #5276 Muhlrad PJ;Ward S Spermiogenesis initiation in Caenorhabditis elegans involves a casein kinase 1 encoded by the spe-6 gene. Genetics 161: 143-155 2002 Made by: Paul Muhlrad Received: 02/28/05 from Ward S, University of Arizona, Tucson -------------------- Strain: BA984 Species: Caenorhabditis elegans Genotype: spe-6(hc163) dpy-18(e364) III. Description: Dpy. spe-6(hc163) suppresses self-sterility of spe-8, spe-12, spe-27, and spe-29 mutants. Causes precocious spermatide activation. Fertile between 15-25C. Mutagen: EMS (hc163) Outcrossed: x Reference: CGC #5276 Muhlrad PJ;Ward S Spermiogenesis initiation in Caenorhabditis elegans involves a casein kinase 1 encoded by the spe-6 gene. Genetics 161: 143-155 2002 Made by: Paul Muhlrad Received: 07/29/03 from Ward S, University of Arizona, Tucson -------------------- Strain: BA989 Species: Caenorhabditis elegans Genotype: spe-6(hc163) III; spe-27(it132) IV. Description: spe-6(hc163) suppresses the ts self-sterile phenotype of spe-27(it132). Also suppresses spe-8, spe-12, and spe-29. Causes precocious spermatid activation. Lays eggs and oocytes. Males are weakly fertile. Fertile between 15-25C. Mutagen: EMS (hc163) Outcrossed: x Reference: CGC #5276 Muhlrad PJ;Ward S Spermiogenesis initiation in Caenorhabditis elegans involves a casein kinase 1 encoded by the spe-6 gene. Genetics 161: 143-155 2002 Made by: Paul Muhlrad Received: 07/29/03 from Ward S, University of Arizona, Tucson -------------------- Strain: BA1013 Species: Caenorhabditis elegans Genotype: spe-6(hc49) vab-7(e1562)/qC1 dpy-19(e1259) glp-1(q339) III; spe-27(it132) IV. Description: Male/hermaphrodite line. Maintain at 15C to insure maintenance of male/hermaphrodite line. Mutagen: Outcrossed: x Reference: CGC #5276 Muhlrad PJ;Ward S Spermiogenesis initiation in Caenorhabditis elegans involves a casein kinase 1 encoded by the spe-6 gene. Genetics 161: 143-155 2002 Made by: Paul Muhlrad Received: 02/28/05 from Ward S, University of Arizona, Tucson -------------------- Strain: BA1044 Species: Caenorhabditis elegans Genotype: spe-27(it132) spe-29(it127) IV; him-5(e1490) V. Description: Non-conditional hermaphrodite sterile. Males fertile. Self-progeny produced after mating. Mutagen: Outcrossed: x Reference: CGC #4444 Nance J;Davis EB;Ward S spe-29 encodes a small predicted protein required for the initiation of sperm activation in Caenorhabditis elegans. Genetics 156: 1623-1633 2000 Made by: Jeremy Nance Received: 01/05/01 from Ward S, University of Arizona, Tucson -------------------- Strain: BA1051 Species: Caenorhabditis elegans Genotype: spe-12(hc76) I; spe-29(it127) IV; him-5(e1490) V. Description: Self-sterile hermaphrodites; fertile males. Mated hermaphrodites produce self and outcross progeny. Self progeny are 33% males. Mutagen: Outcrossed: x Reference: CGC #4444 Nance J;Davis EB;Ward S spe-29 encodes a small predicted protein required for the initiation of sperm activation in Caenorhabditis elegans. Genetics 156: 1623-1633 2000 Made by: Jeremy Nance Received: 01/05/01 from Ward S, University of Arizona, Tucson -------------------- Strain: BA1061 Species: Caenorhabditis elegans Genotype: dpy-18(e364) spe-6(hc49) ale-1(mc14)/qC1 dpy-19(e1259) glp-1(q339) III. Description: Heterozygotes are WT and segregate WT, Sterile Dpys (Dpy is temperature sensitive), and dead eggs. ale-1 is a recessive embryonic lethal. Mutagen: Outcrossed: x Reference: CGC #5276 Muhlrad PJ;Ward S Spermiogenesis initiation in Caenorhabditis elegans involves a casein kinase 1 encoded by the spe-6 gene. Genetics 161: 143-155 2002 Made by: Paul Muhlrad Received: 02/28/05 from Ward S, University of Arizona, Tucson -------------------- Strain: BA1069 Species: Caenorhabditis elegans Genotype: F26F4.8(hc180) III. Description: Deletion allele of F26F4.8. Homologous to Zn finger of Drosophila ovo transcription factor. Developmental defects in hind gut, germline and vulva. HES primers 106/107 outer and HES 108/109 inner. Mutagen: UV/TMP Outcrossed: x6 Reference: Made by: H. Smith Received: 10/15/01 from Ward S, University of Arizona, Tucson -------------------- Strain: BA1070 Species: Caenorhabditis elegans Genotype: cdh-5(hc181) IV. Description: Deletion allele of F08B4.2. Homologous to Drosophila fat cadherin. Primers HES 114/115 outer and HES 116/117 inner. Mutagen: UV/TMP Outcrossed: x2 Reference: Made by: H. Smith Received: 10/15/01 from Ward S, University of Arizona, Tucson -------------------- Strain: BA1073 Species: Caenorhabditis elegans Genotype: dyf-5(hc183) I. Description: Deletion allele of M04C9.5 (mak-kinase). No visible phenotype in hermaphrodites. Primers HES 186/187 outer and HES 188/189 inner. Mutagen: Outcrossed: x0 Reference: Made by: H. Smith Received: 10/15/01 from Ward S, University of Arizona, Tucson -------------------- Strain: BA1083 Species: Caenorhabditis elegans Genotype: F43G6.6(hc184) II. Description: Deletion allele of F43G6.6. No obvious phenotype in hermaphrodites. HES primers 162/163 outer and 164/165 inner. Mutagen: UV/TMP Outcrossed: x0 Reference: Made by: H. Smith Received: 10/15/01 from Ward S, University of Arizona, Tucson -------------------- Strain: BA1084 Species: Caenorhabditis elegans Genotype: F09C12.2(hc185) II. Description: Deletion allele of F09C12.2. No obvious phenotype in hermaphrodites. HES primers 122/123 outer and HES 124/125 inner. Mutagen: UV/TMP Outcrossed: x0 Reference: Made by: H. Smith Received: 10/15/01 from Ward S, University of Arizona, Tucson -------------------- Strain: BA1090 Species: Caenorhabditis elegans Genotype: cav-2(hc191) V. Description: No visible phenotype in hermaphrodites. Deletion allele of C56A3.7. Mutagen: TMP Outcrossed: x6 Reference: Made by: HES Received: 07/26/01 from Ward S, University of Arizona, Tucson -------------------- Strain: BA1091 Species: Caenorhabditis elegans Genotype: C35D10.2(hc192) III. Description: No visible phenotype in hermaphrodites. Primes HES 146/146 and HES 148/149. Mutagen: TMP Outcrossed: x6 Reference: Made by: HES Received: 10/23/01 from Ward S, University of Arizona, Tucson -------------------- Strain: BA1093 Species: Caenorhabditis elegans Genotype: snf-10(hc194) V. Description: Y32F6A.2 No visible phenotype in hermaphrodites. Primers: outer HES 22/228 and inner HES 229/230. Mutagen: TMP Outcrossed: x6 Reference: Made by: H. Smith Received: 10/15/01 from Ward S, University of Arizona, Tucson -------------------- Strain: BB1 Species: Caenorhabditis elegans Genotype: dcr-1(ok247)/unc-32(e189) III. Description: Heterozygotes are WT and segregate WT, Uncs, and Steriles. Mutagen: EMS Outcrossed: x8 Reference: CGC #4870 Knight SW;Bass BL A role for the RNase III enzyme DCR-1 in RNA interference and germ line development in Caenorhabditis elegans. Science 293: 2269-2271 2001 Made by: B. Barstead Received: 01/30/02 from Bass B, University of Utah, Salt Lake City, UT -------------------- Strain: BB2 Species: Caenorhabditis elegans Genotype: adr-1(gv6) I. Description: Defective chemotaxis to volatile odorant. Low percentage (about 6%) have protruding vulva. Mutagen: EMS Outcrossed: x8 Reference: CGC #5596 Tonkin LA;Saccomanno L;Morse DP;Brodigan T;Krause M;Bass BL RNA editing by ADARs is important for normal behavior in Caenorhabditis elegans. EMBO Journal 22: 6025-6035 2002 Made by: Michael Krause Received: 02/05/03 from Bass B, University of Utah, Salt Lake City, UT -------------------- Strain: BB3 Species: Caenorhabditis elegans Genotype: adr-2(gv42) III. Description: Defective chemotaxis to volatile odorant. Mutagen: EMS Outcrossed: x8 Reference: CGC #5596 Tonkin LA;Saccomanno L;Morse DP;Brodigan T;Krause M;Bass BL RNA editing by ADARs is important for normal behavior in Caenorhabditis elegans. EMBO Journal 22: 6025-6035 2002 Made by: Michael Krause Received: 02/05/03 from Bass B, University of Utah, Salt Lake City, UT -------------------- Strain: BB4 Species: Caenorhabditis elegans Genotype: adr-1(gv6) I; adr-2(gv42) III. Description: Defective chemotaxis to volatile odorant. Low percentage (about 6%) have protruding vulva. Mutagen: Outcrossed: x Reference: CGC #5596 Tonkin LA;Saccomanno L;Morse DP;Brodigan T;Krause M;Bass BL RNA editing by ADARs is important for normal behavior in Caenorhabditis elegans. EMBO Journal 22: 6025-6035 2002 Made by: Michael Krause Received: 02/05/03 from Bass B, University of Utah, Salt Lake City, UT -------------------- Strain: BB92 Species: Caenorhabditis elegans Genotype: dcr-1(ok247) III; uuEx18. Description: uuEx18 [dcr-1(wild-type) + dpy-30::mCherry]. Superficially wild-type. Reference: Welker N, et al. (2010) RNA 16:893-903. Mutagen: Outcrossed: x3 Reference: Made by: Noah Welker Received: 10/20/10 from Bass B, University of Utah, Salt Lake City, UT -------------------- Strain: BB93 Species: Caenorhabditis elegans Genotype: dcr-1(ok247) III; uuEx19. Description: uuEx19 [dcr-1(K39A) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903. Mutagen: Outcrossed: x3 Reference: Made by: Noah Welker Received: 10/20/10 from Bass B, University of Utah, Salt Lake City, UT -------------------- Strain: BB94 Species: Caenorhabditis elegans Genotype: dcr-1(ok247) III; uuEx20. Description: uuEx20 [dcr-1(D145N) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903. Mutagen: Outcrossed: x3 Reference: Made by: Noah Welker Received: 10/20/10 from Bass B, University of Utah, Salt Lake City, UT -------------------- Strain: BB95 Species: Caenorhabditis elegans Genotype: dcr-1(ok247) III; uuEx21. Description: uuEx21 [dcr-1(G492R) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903. Mutagen: Outcrossed: x3 Reference: Made by: Noah Welker Received: 10/20/10 from Bass B, University of Utah, Salt Lake City, UT -------------------- Strain: BC14838 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14838. Description: sEx14838[rCesC24B9.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Reference: Made by: Domena Tu Received: 05/14/07 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC14839 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14839. Description: sEx14839[rCesC24B9.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Reference: Made by: Domena Tu Received: 05/14/07 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC14840 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14840. Description: sEx14840[rCesF47D2.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Reference: Made by: Domena Tu Received: 05/14/07 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC14832 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14832. Description: sEx14832[rCesC36C5.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Reference: Made by: Domena Tu Received: 05/14/07 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC15345 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx15345. Description: sEx15345[rCesC03A7.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Reference: Made by: Domena Tu Received: 05/14/07 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC14751 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14751. Description: sEx14751[rCesC50H11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Reference: Made by: Domena Tu Received: 05/14/07 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC14738 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14738. Description: sEx14738[rCesF59A7.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Reference: Made by: Domena Tu Received: 05/14/07 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC18 Species: Caenorhabditis elegans Genotype: unc-22(s13)IV. Description: Twitcher Unc. Heterozygotes twitch in 1% Nicotine. Recessive. Mutagen: EMS Outcrossed: x Reference: CGC #245 Moerman DG;Baillie DL Genetic organization in C. elegans: Fine-structure analysis of the unc-22 gene. Genetics 91: 95-104 1979 Made by: Moerman D Received: 08/01/80 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC21 Species: Caenorhabditis elegans Genotype: unc-22(s8)IV. Description: Twitcher Unc. Recessive. Heterozygotes twitch in 1% Nicotine. Mutagen: EMS Outcrossed: x Reference: CGC #245 Moerman DG;Baillie DL Genetic organization in C. elegans: Fine-structure analysis of the unc-22 gene. Genetics 91: 95-104 1979 Made by: Moerman D Received: 07/01/80 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC23 Species: Caenorhabditis elegans Genotype: unc-22(s7)IV. Description: Twitcher Unc. Recessive. Heterozygotes twitch in 1% Nicotine Mutagen: EMS Outcrossed: x Reference: CGC #245 Moerman DG;Baillie DL Genetic organization in C. elegans: Fine-structure analysis of the unc-22 gene. Genetics 91: 95-104 1979 Made by: Moerman D Received: 07/01/80 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC96 Species: Caenorhabditis elegans Genotype: unc-22(s16)IV. Description: Twitcher Unc. Recessive. Heterozygoters twitch in 1% Nicotine. Mutagen: EMS Outcrossed: x Reference: CGC #245 Moerman DG;Baillie DL Genetic organization in C. elegans: Fine-structure analysis of the unc-22 gene. Genetics 91: 95-104 1979 Made by: Moerman D Received: 07/01/80 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC107 Species: Caenorhabditis elegans Genotype: bli-4(e937) dpy-14(e188) I. Description: Blistered. Dpy (ts). Mutagen: Outcrossed: x Reference: Made by: Ann Rose Received: 10/06/99 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC110 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-85(s142)/unc-15(e73)I. Description: Heterozygotes are WT and segregate WT, Unc and DpyUncLets. Lethal at L1. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Ann Rose Received: 01/26/93 from Rose A, University of British Columbia, Vancouver -------------------- Strain: BC112 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-82(s85)/unc-15(e73)I. Description: Heterozygotes are WT and segregate more WT, paralyzed Unc, and DpyUncLet (DpyUnc Larvae are abnormal). Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Ann Rose Received: 09/01/82 from Rose A, University of British Columbia, Vancouver -------------------- Strain: BC115 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-81(s88)/unc-15(e73)I. Description: Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncLets are abnormal larvae and die in early larval development. Pick WT to maintain. Mutagen: EMS Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Ann Rose Received: 09/01/82 from Rose A, University of British Columbia, Vancouver -------------------- Strain: BC119 Species: Caenorhabditis elegans Genotype: dpy-24(s71)I. Description: Dpy. Mutagen: EMS Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Rose A Received: 09/01/82 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC123 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-84(s91)/unc-15(e73)I. Description: Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLet. The DpyUncs are abnormal larvae that die in late larval development. Pick WT to maintain. Mutagen: EMS Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Ann Rose Received: 09/01/82 from Rose A, University of British Columbia, Vancouver -------------------- Strain: BC124 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) unc-37(s80)/unc-15(e73)I. Description: Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLet. The DpyUncLet larvae are abnormal. Pick WT to maintain. Mutagen: Outcrossed: x Reference: Made by: Received: 09/01/82 from Rose A, University of British Columbia, Vancouver -------------------- Strain: BC125 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-79(s81)/unc-15(e73)I. Description: Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethal. The DpyUncs are abnormal larvae that die in early larval development. Pick WT to maintain. Note 5/92: probably has lost dpy-14. Mutagen: EMS Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Ann Rose Received: 09/01/82 from Rose A, University of British Columbia, Vancouver -------------------- Strain: BC148 Species: Caenorhabditis elegans Genotype: dpy-14(e188) myo-1(s101) unc-13(e51)/unc-15(e73)I. Description: Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae that die in early larval development (L1). Pick WT to maintain. Previously called myo-1(s101). Mutagen: EMS Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Rose A Received: 08/01/80 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC149 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-83(s97)/unc-15(e73)I. Description: Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUnc are abnormal larvae which die in early larval development. Pick WT to maintain. Mutagen: EMS Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Rose A Received: 06/01/82 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC157 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-80(s96)/unc-15(e73)I. Description: Heterozygotes are WT and segregate more WT, paralyzed Unc and Lethal DpyUncs. Lethal early larval. Pick WT to maintain. Mutagen: EMS Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Rose A Received: 06/01/82 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC159 Species: Caenorhabditis elegans Genotype: dpy-5(e61) unc-13(e51)I; sDp1(I;f). Description: Animals with the duplication are WT. Animals which have lost the duplication are DpyUnc. Segregates 2% males. The males are sterile. The duplication is homozygous lethal. Mutagen: Gamma ray Outcrossed: x0 Reference: CGC #699 Rose AM;Baillie DL;Curran J Meiotic pairing behavior of two free duplications of linkage group I in C. elegans. Molecular & General Genetics 195: 52-56 1984 Made by: Rose A Received: 07/01/80 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC160 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-87(s106)/unc-15(e73)I. Description: Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethal. Lethal early larval (L1). Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Rose A Received: 08/01/80 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC162 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-88(s132)/unc-15(e73)I. Description: Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethal. The DpyUncs are abnormal larvae which die in early larval development. Pick WT to maintain. Mutagen: EMS Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Rose A Received: 06/01/82 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC165 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-89(s133)/unc-15(e73)I. Description: Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethal. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Ann Rose Received: 09/01/82 from Rose A, University of British Columbia, Vancouver -------------------- Strain: BC177 Species: Caenorhabditis elegans Genotype: unc-22(s17)IV. Description: Twitcher. Both heterozygotes and homozygotes twitch in 1% nicotine. Mutagen: EMS Outcrossed: x Reference: CGC #245 Moerman DG;Baillie DL Genetic organization in C. elegans: Fine-structure analysis of the unc-22 gene. Genetics 91: 95-104 1979 Made by: D. Moerman Received: 08/01/80 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC184 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) bli-4(s90)/unc-15(e73)I. Description: Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae which die in late larval development. Pick WT to maintain. s90 previously called let-77. See also WBPaper00003507. CGC received new stock 3/01. Mutagen: EMS Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Ann Rose Received: 09/01/82 from Rose A, University of British Columbia, Vancouver -------------------- Strain: BC196 Species: Caenorhabditis elegans Genotype: dpy-5(e61) dpy-14(e188) rec-1(s180)I. Description: Dpy. Best maintained at 16C (dpy-14 is ts). High recombination. Mutagen: Outcrossed: x Reference: CGC #321 Rose AM;Baillie DL A mutation in C. elegans that increases recombination frequency more then threefold. Nature 281: 599-600 1979 Made by: Ann Rose Received: 01/28/88 from Rose A, University of British Columbia, Vancouver -------------------- Strain: BC199 Species: Caenorhabditis elegans Genotype: sDf6/unc-15(e73)I. Description: Heterozygotes are WT and segregate WT, Paralyzed Unc and Lethals (L1). Pick WT to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Rose A Received: 12/01/81 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC200 Species: Caenorhabditis elegans Genotype: unc-22(s12)IV. Description: Twitcher Unc. Recessive. Heterozygotes twitch in 1% Nicotine. Mutagen: EMS Outcrossed: x Reference: CGC #245 Moerman DG;Baillie DL Genetic organization in C. elegans: Fine-structure analysis of the unc-22 gene. Genetics 91: 95-104 1979 Made by: Moerman D Received: 07/01/80 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC215 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-78(s82)/unc-15(e73)I. Description: Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae which die in late larval development. Pick WT to maintain. Mutagen: EMS Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Ann Rose Received: 09/01/82 from Rose A, University of British Columbia, Vancouver -------------------- Strain: BC220 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-90(s140)/unc-15(e73)I. Description: Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethal. The DpyUncs are abnormal larvae. Pick WT to maintain. Mutagen: EMS Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Ann Rose Received: 09/01/82 from Rose A, University of British Columbia, Vancouver -------------------- Strain: BC244 Species: Caenorhabditis elegans Genotype: dpy-14(e188) let-86(s141) unc-13(e51)/unc-15(e73)I. Description: Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae which die in early larval development. Pick WT to maintain. Mutagen: EMS Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Rose A Received: 06/01/82 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC277 Species: Caenorhabditis elegans Genotype: unc-46(e177) dpy-11(e224)V. Description: DpyUnc. Medium Dpy. Shrinker. Poor backing. Slow, good forward movement. Mutagen: Outcrossed: x6 Reference: CGC #31 Brenner S The genetics of Caenorhabditis elegans. Genetics 77: 71-94 1974 Made by: Dave Baillie Received: 04/01/85 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC313 Species: Caenorhabditis elegans Genotype: rec-1(s180)I. Description: Increased recombination (3X - 4X over WT) for linkage groups I, IV and V. Recessive. Dominant with s155. Mutagen: Outcrossed: x Reference: CGC #321 Rose AM;Baillie DL A mutation in C. elegans that increases recombination frequency more then threefold. Nature 281: 599-600 1979 Made by: Rose A Received: 08/01/80 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC331 Species: Caenorhabditis elegans Genotype: let-54(s44) unc-22(s7)/+ + IV. Description: Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal early larval (L1-L2). Pick heterozygotes to maintain by picking Twitchers in 1% nicotine. Mutagen: EMS Outcrossed: x Reference: CGC #592 Rogalski TM;Moerman DG;Baillie DL Essential genes and deficiencies in the unc-22 IV region of C. elegans. Genetics 102: 725-736 1982 Made by: Moerman D Received: 12/01/83 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC347 Species: Caenorhabditis elegans Genotype: unc-54(s74)I. Description: Paralyzed Rigid Unc. Muscle birefrigence normal. Muscle normal in EM. Mutagen: EMS Outcrossed: x0 Reference: Made by: Moerman D Received: 04/01/80 from Waterston B, University of Washington, Seattle, WA -------------------- Strain: BC352 Species: Caenorhabditis elegans Genotype: let-51(s41) unc-22(s7)/sDf2 IV. Description: Heterozygotes are Twitchers and segregate Twitchers, twitcher progeny that block in egg and dead eggs. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #499 Moerman DG;Baillie DL Formaldehyde mutagenesis in the nematode C. elegans. Mutation Research 80: 273-279 1981 Made by: Don Moerman Received: 09/01/82 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC364 Species: Caenorhabditis elegans Genotype: dpy-11(e224) unc-68(e540)V. Description: DpyUnc. Mutagen: Outcrossed: x Reference: Made by: R. Rosenbluth Received: 04/01/85 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC369 Species: Caenorhabditis elegans Genotype: unc-5(e152) let-55(s45) unc-22(s7)/unc-5(e152)IV. Description: Heterozygotes are Unc and segregate Unc and Lethal Unc Twitchers. Lethal early larval. Heterozygotes twitch in 1% nicotine. Mutagen: EMS Outcrossed: x Reference: CGC #592 Rogalski TM;Moerman DG;Baillie DL Essential genes and deficiencies in the unc-22 IV region of C. elegans. Genetics 102: 725-736 1982 Made by: Moerman D Received: 12/01/83 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC439 Species: Caenorhabditis elegans Genotype: sDf7/unc-31(e169) dpy-4(e1166)IV. Description: Heterozygotes are WT and segregate DpyUncs and early larval lethals. Heterozygotes twitch in 1% Nicotine. Pick WT to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #499 Moerman DG;Baillie DL Formaldehyde mutagenesis in the nematode C. elegans. Mutation Research 80: 273-279 1981 Made by: Moerman D Received: 06/01/82 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC442 Species: Caenorhabditis elegans Genotype: sDf10/unc-31(e169)IV. Description: Heterozygotes twitch in 1% nicotine. Hets are slow, and are somewhat difficult to distinguish from unc-31 homozygotes. Df/Df homozygotes die as early larvae. Maintain by picking twitchers in 1% nicotine. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #592 Rogalski TM;Moerman DG;Baillie DL Essential genes and deficiencies in the unc-22 IV region of C. elegans. Genetics 102: 725-736 1982 Made by: Moerman D Received: 06/01/82 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC455 Species: Caenorhabditis elegans Genotype: unc-15(e73) unc-13(e51)I. Description: Paralysed Unc. Mutagen: Outcrossed: x Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Ann Rose Received: 06/12/87 from Rose A, University of British Columbia, Vancouver -------------------- Strain: BC694 Species: Caenorhabditis elegans Genotype: sDf5/unc-15(e73)I. Description: Heterozygotes are WT and segregate more WT, Uncs and L1 lethals. Pick WT to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: EMS Outcrossed: x>1 Reference: CGC #427 Rose AM;Baillie DL Genetic organization of the region around unc-15(I), a gene affecting paramyosin in C. elegans. Genetics 96: 639-648 1980 Made by: Rose A Received: 02/01/82 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC700 Species: Caenorhabditis elegans Genotype: sDf4/bli-4(e937) dpy-14(e188)I. Description: Heterozygotes are semi-Dpy and segregate more semi-Dpy, Dpy(ts)Bli(late) and early larval lethals. Pick semi-Dpy to maintain. (Some reports indicate that sDf4 is not transferred through sperm.) This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #975 Howell AM;Gilmour SG;Mancebo RA;Rose AM Genetic analysis of a large autosomal region in C. elegans by the use of a free duplication. Genetical Research 49: 207-213 1987 Made by: Rose A Received: 06/01/82 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC917 Species: Caenorhabditis elegans Genotype: let-61(s65) unc-22(s7)/+ + IV. Description: Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal late larval. Maintain by picking WT which throw Lethal Twitchers. Hets twitch in 1% Nicotine. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Rogalski T Received: 12/01/83 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC918 Species: Caenorhabditis elegans Genotype: let-63(s170) unc-22(s7)/+ + IV. Description: Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal mid larval. Maintain by picking WT which throw Lethal Twitchers. Hets twitch in 1% Nicotine. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Rogalski T Received: 12/01/83 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC933 Species: Caenorhabditis elegans Genotype: unc-22(s7) let-66(s176)/+ + IV. Description: Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal early larval. Heterozygotes twitch in 1% nicotine. Mutagen: Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Rogalski T Received: 12/01/83 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC934 Species: Caenorhabditis elegans Genotype: let-59(s175) unc-22(s7)/+ + IV. Description: Heterozygotes are WT and segregate WT and dead eggs. Hets twitch in 1% nicotine. Maintain by picking Twitchers in 1% Nicotine. Mutagen: Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Rogalski T Received: 12/01/83 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC954 Species: Caenorhabditis elegans Genotype: let-64(s216) unc-22(s7)/+ + IV. Description: Heterozygotes are WT (twitch in 1% nicotine) and segregate WT and thin, twitcher sterile adults. Pick twitchers in 1% nicotine to maintain. Mutagen: Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: T. Rogalski Received: 08/01/84 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC962 Species: Caenorhabditis elegans Genotype: let-65(s254) unc-22(s7)/+ + IV. Description: Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal mid-larval. Heterozygotes twitch in 1% Nicotine. Maintain by picking Twitchers in 1% Nicotine. Mutagen: Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: T. Rogalski Received: 12/01/83 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC964 Species: Caenorhabditis elegans Genotype: let-56(s46) unc-22(s7)/unc-5(e152) dpy-4(e1166)IV. Description: Heterozygotes are WT and segregate more WT, DpyUncs and Lethal Twitchers. Lethal late larval. Heterozygotes Twitch in 1% Nicotine. Pick WT to maintain. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Rogalski T Received: 03/01/82 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC965 Species: Caenorhabditis elegans Genotype: let-59(s49) unc-22(s7)/unc-5(e152) dpy-4(e1166)IV. Description: Heterozygotes are WT and segregate WT, DpyUnc and Lethal Twitchers. Lethal early larval. Hets twitch in 1% Nicotine. Pick WT to maintain. Mutagen: EMS Outcrossed: x Reference: CGC #499 Moerman DG;Baillie DL Formaldehyde mutagenesis in the nematode C. elegans. Mutation Research 80: 273-279 1981 Made by: Rogalski T Received: 03/01/82 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC966 Species: Caenorhabditis elegans Genotype: let-60(s59) unc-22(s7)/unc-5(e152) dpy-4(e1166)IV. Description: Heterozygotes are WT and segregate WT, DpyUnc, and Lethal Twitchers. Lethal mid-larval (leaky). Heterozygotes twitch in nicotine. Mutagen: Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Rogalski T Received: 03/01/82 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC986 Species: Caenorhabditis elegans Genotype: sDp3(III;f); eT1(III;V). Description: Throws Unc-36 and WT. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma Rays Outcrossed: x Reference: CGC #750 Rosenbluth RE;Cuddeford C;Baillie DL Mutagenesis in Caenorhabditis elegans. II. A spectrum of mutational events induced with 1500 R of gamma-radiation. Genetics 109: 493-511 1985 Made by: R. Rosenbluth Received: 07/01/85 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC987 Species: Caenorhabditis elegans Genotype: unc-22(s7) let-52(s42)/+ + IV. Description: Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal early larval. Hets twitch in 1% Nicotine. Pick WT to maintain. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: T. Roglaski Received: 12/01/83 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC11504 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11504. Description: sEx11504[rCesY8G1A.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Reference: Made by: Allan Mah Received: 07/11/07 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1201 Species: Caenorhabditis elegans Genotype: sDf19/nT1 IV; +/nT1 V. Description: sDf19 has a dominant twitcher phenotype, and is homozygous lethal-usually arresting as embryos, but occasionally will hatch. Heterozygotes are twitchers and segregate twitchers, Vulvaless and dead eggs (or lethal early larvae). This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Outcrossed: x Reference: CGC #1689 Marra MA;Prasad SS;Baillie DL Molecular analysis of two genes between let-653 and let-56 in the unc-22(IV) region of Caenorhabditis elegans. Molecular & General Genetics 236: 289-298 1993 Made by: T. Rogalski Received: 10/01/84 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1216 Species: Caenorhabditis elegans Genotype: sDf21 dpy-4/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma rays Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Wild G Received: 01/14/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1217 Species: Caenorhabditis elegans Genotype: sDf22/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma rays Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: G. Wild Received: 12/15/87 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1227 Species: Caenorhabditis elegans Genotype: sDf23/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma Rays Outcrossed: x Reference: Made by: Dave Baillie Received: 01/05/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1230 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf27 unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma rays Outcrossed: x Reference: CGC #750 Rosenbluth RE;Cuddeford C;Baillie DL Mutagenesis in Caenorhabditis elegans. II. A spectrum of mutational events induced with 1500 R of gamma-radiation. Genetics 109: 493-511 1985 Made by: R. Rosenbluth Received: 07/01/85 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1282 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-62(s472) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. Unc-62 is a recessive lethal. Mutagen: No mutagen used-control screen Outcrossed: x Reference: CGC #750 Rosenbluth RE;Cuddeford C;Baillie DL Mutagenesis in Caenorhabditis elegans. II. A spectrum of mutational events induced with 1500 R of gamma-radiation. Genetics 109: 493-511 1985 Made by: R. Rosenbluth Received: 07/01/85 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1283 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) sDf20/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma rays Outcrossed: x Reference: CGC #750 Rosenbluth RE;Cuddeford C;Baillie DL Mutagenesis in Caenorhabditis elegans. II. A spectrum of mutational events induced with 1500 R of gamma-radiation. Genetics 109: 493-511 1985 Made by: R. Rosenbluth Received: 10/01/85 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1287 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf26/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma rays Outcrossed: x Reference: CGC #750 Rosenbluth RE;Cuddeford C;Baillie DL Mutagenesis in Caenorhabditis elegans. II. A spectrum of mutational events induced with 1500 R of gamma-radiation. Genetics 109: 493-511 1985 Made by: Received: 07/01/85 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1289 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf28 unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma rays Outcrossed: x Reference: CGC #750 Rosenbluth RE;Cuddeford C;Baillie DL Mutagenesis in Caenorhabditis elegans. II. A spectrum of mutational events induced with 1500 R of gamma-radiation. Genetics 109: 493-511 1985 Made by: R. Rosenbluth Received: 07/01/85 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1291 Species: Caenorhabditis elegans Genotype: let-93(s734) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Leo Donati Received: 12/12/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1381 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) sDf29/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma rays Outcrossed: x Reference: CGC #750 Rosenbluth RE;Cuddeford C;Baillie DL Mutagenesis in Caenorhabditis elegans. II. A spectrum of mutational events induced with 1500 R of gamma-radiation. Genetics 109: 493-511 1985 Made by: R. Rosenbluth Received: 08/01/84 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1424 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-331(s427) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Homozygous s427 is a cold sensitive sterile adult.(??) Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Rosenbluth R Received: 11/13/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1433 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-345(s578) unc-46(e177)/eT1 V. Description: WT strain which segregates WT, Unc-36, dead eggs, and DpyUncLets. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Rosenbluth Received: 02/22/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1434 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-330(s573) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, DpyUncLet and dead eggs. Lethal mid larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Rosenbluth Received: 02/03/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1435 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-329(s575)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Some DpyUnc escapers are Sterile and have a protruding vulva. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Rosenbluth R Received: 11/13/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1439 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-344(s376) unc-46(e177)/eT1 V. Description: WT strain which segregates WT, Unc-36, and dead eggs. (Egg lethal.) Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Rosenbluth R Received: 11/13/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1466 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-326(s238) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, dead eggs and DpyUncLets. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Rosenbluth Received: 07/01/85 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1480 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-332(s234)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, and dead eggs. Egg lethal. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Rosenbluth R Received: 11/27/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1481 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-350(s250) unc-46(e177)/eT1 V. Description: WT strain which segregates WT, Unc-36, dead eggs and DpyUncLet. Lethal late larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Rosenbluth R Received: 11/15/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1483 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-419(s219)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Rosenbluth Received: 01/19/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1519 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf31/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. Original isolation: BO strain BC1261 unc-22(s727) hermaphrodite heat shocked for 1 hour at 34C. Crossed to N2 strain BC1270 unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Picked individual WT hermaphrodites. Screened for the absence of gravid Unc-22. Retained strain as BC1379. Balanced over eT1: BC1379 unc-22(s727)[BO]/nT1[N2] IV; sDf31[BO]/nT1[N2] hermaphrodite crossed to BC 1265 dpy-18(e364)/eT1 III; unc-46(e177)/eT1 V. Pick WT hermaphrodites that twitch in 1% nicotine. Retained one strain that segregated Unc-36 as BC1428. Pseudolinked sDf31 to dpy-18: BC1428 +/eT1 III; sDf31[BO]/eT1 V crossed to BC 1265 dpy-18/eT1 III; unc-46/eT1 V male. Picked WT hermaphrodite F1. From strains segregating Unc-36 but no Dpy or Unc-46 or DpyUnc-46, cross WT hermaphrodites to BC1265 males. From strains producing Dpy, crossed individual WT males to BC70 eT1;eT1. From each cross, crossed WT X WT. Kept one strain producing on Dpy or DpyUncs as S-H716 male. Picked one hermaphrodite to start BC1519. Comments: 1) The LGV region balanced by eT1 should be all BO. 2) Probably the rest of the genome still has a considerable amount from BO since it was crossed to N2 only 4 times. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Tc1? Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Leo Donati Received: 02/03/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1521 Species: Caenorhabditis elegans Genotype: dpy-18(e364) III/eT1[let-?(s1799)](III;V); let-327(s247) unc-46(e177) V/eT1[let-?(s1799)](III;V). Description: Heterozygotes are WT and throw WT, DpyUncLet and dead eggs. DpyUncLet are translucent, have slow development, are cold sensitive and die as late larvals. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Rosenbluth Received: 07/01/85 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1548 Species: Caenorhabditis elegans Genotype: unc-22(s7) let-67(s214)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul and Twitcher Steriles. The sterility can be rescued by male sperm. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Moerman & Rogalski Received: 12/30/94 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1549 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-349(s217)/eT1 V. Description: WT strain which segregates WT, Unc-36, dead eggs and DpyUncLets. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Rosenbluth Received: 01/19/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1554 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf32 unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: EMS Outcrossed: x Reference: CGC #1018 McKim KS;Heschl MFP;Rosenbluth RE;Baillie DL Genetic organization of the unc-60 region in Caenorhabditis elegans. Genetics 118: 49-59 1988 Made by: R. Rosenbluth Received: 07/01/85 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1572 Species: Caenorhabditis elegans Genotype: +/eT1 III; let-401(s193) dpy-11(e224) unc-42(e270)/eT1 V. Description: WT strain which segregates WT, Unc-36, dead eggs and DpyUncLets. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Roglaski/Rosenbluth Received: 10/01/85 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1573 Species: Caenorhabditis elegans Genotype: +/eT1 III; let-402(s127) dpy-11(e224) unc-42(e270)/eT1 V. Description: WT strain which segregates WT, Unc-36, dead eggs and DpyUncLets. Lethal mid larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Rosenbluth Received: 10/01/85 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1574 Species: Caenorhabditis elegans Genotype: +/eT1 III; let-403(s120) dpy-11(e224) unc-42(e270)/eT1 V. Description: WT strain which segregates WT, Unc-36, dead eggs and DpyUncLets. Lethal mid-late larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Rogalski/Rosenbluth Received: 10/01/85 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1751 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-466(s1063) unc-46(e177)/eT1 V. Description: WT strain which segregates WT, Unc-36, dead eggs and DpyUncs. The DpyUncs throw DpyUncs that are Sterile adults. (Mel->Sterile adult in F2.) Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 11/15/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1772 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-334(s908)/eT1 V. Description: Heterozygotes are WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: M. Khosla Received: 02/03/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1781 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf33 unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma rays Outcrossed: x Reference: CGC #1018 McKim KS;Heschl MFP;Rosenbluth RE;Baillie DL Genetic organization of the unc-60 region in Caenorhabditis elegans. Genetics 118: 49-59 1988 Made by: R. Devlin Received: 04/28/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1782 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf34 unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma Rays Outcrossed: x Reference: CGC #1018 McKim KS;Heschl MFP;Rosenbluth RE;Baillie DL Genetic organization of the unc-60 region in Caenorhabditis elegans. Genetics 118: 49-59 1988 Made by: R. Devlin Received: 04/15/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1784 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) sDf36/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: No mutagen used Outcrossed: x Reference: CGC #750 Rosenbluth RE;Cuddeford C;Baillie DL Mutagenesis in Caenorhabditis elegans. II. A spectrum of mutational events induced with 1500 R of gamma-radiation. Genetics 109: 493-511 1985 Made by: R. Rosenbluth Received: 07/01/85 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1785 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) sDf30/eT1 V. Description: WT strain that segregates WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma rays Outcrossed: x Reference: CGC #750 Rosenbluth RE;Cuddeford C;Baillie DL Mutagenesis in Caenorhabditis elegans. II. A spectrum of mutational events induced with 1500 R of gamma-radiation. Genetics 109: 493-511 1985 Made by: R. Rosenbluth Received: 01/19/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1907 Species: Caenorhabditis elegans Genotype: let-68(s1081) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul and LetUncTwitcher. Lethal ??. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Denise Clark Received: 09/02/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1912 Species: Caenorhabditis elegans Genotype: let-652(s1086) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Egl, dead eggs and UncLets. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1522 Clark DV;Baillie DL Genetic analysis and complementation by germ-line transformation of lethal mutations in the unc-22 IV region of Caenorhabditis elegans. Molecular & General Genetics 232: 97-105 1992 Made by: Denise Clark Received: 01/05/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1919 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-343(s1025)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Egg lethal. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Johnsen Received: 04/15/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1922 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-342(s1029) unc-46(e177)/eT1 V. Description: WT strain that segregates WT, Unc-36, dead eggs and DpyUncLets. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Johnsen Received: 02/03/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1924 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-340(s1022)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Johnsen Received: 02/03/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1925 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sos-1(s1031) unc-46(e177)/eT1 V. Description: WT strain that segregates WT, Unc-36 (eT1 homozygotes), and dead eggs. s1031 is an egg lethal. Maintain by picking WT. Previously called let-341(s1031). Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Johnsen Received: 01/19/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1927 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-347(s1035) unc-46(e177)/eT1 V. Description: WT strain that segregates WT, Unc-36, dead eggs and DpyUncLets. Lethal late larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Johnsen Received: 02/03/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1958 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncs and dead eggs. Maintain by picking WT. Mutagen: Outcrossed: x Reference: Made by: Rosenbluth R Received: 11/05/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1972 Species: Caenorhabditis briggsae Genotype: Cbr-unc(s1270). Description: C. briggsae strain. Twitcher. Hets twitch only in prescence of nicotine. Mutagen: EMS Outcrossed: x2 Reference: Made by: S. Bird Received: 05/07/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1977 Species: Caenorhabditis briggsae Genotype: Cbr-unc(s1275). Description: C. briggsae strain. Unc-tends to coil. Mutagen: EMS Outcrossed: x1 Reference: Made by: S. Bird Received: 05/07/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1983 Species: Caenorhabditis briggsae Genotype: Cbr-dpy(s1281). Description: C. briggsae strain. Chubby. Moves poorly. Mutagen: EMS Outcrossed: x1 Reference: Made by: S. Bird Received: 05/07/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC1999 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; nDf18/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. Mutagen: Outcrossed: x Reference: CGC #1018 McKim KS;Heschl MFP;Rosenbluth RE;Baillie DL Genetic organization of the unc-60 region in Caenorhabditis elegans. Genetics 118: 49-59 1988 Made by: R. Rosenbluth Received: 11/30/87 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2001 Species: Caenorhabditis elegans Genotype: let-98(s1117) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal late larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: D. Clark Received: 12/12/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2003 Species: Caenorhabditis elegans Genotype: let-96(s1112) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, Lethal Twitchers and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: D. Clark Received: 12/12/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2008 Species: Caenorhabditis elegans Genotype: unc-22(s7) unc-31(e169) let-315(s1101)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1303 Charest DL;Clark DV;Green ME;Baillie DL Genetic and fine-structure analysis of unc-26(IV) and adjacent regions in Caenorhabditis elegans. Molecular & General Genetics 221: 459-465 1990 Made by: Clark D Received: 08/27/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2010 Species: Caenorhabditis elegans Genotype: let-60(s1124) unc-22(s7) unc-31(e169) IV/nT1 (IV;V). Description: Heterozygotes are WT and segregate WT, Vul and UncLethals. Strong allele of let-60. Unc Twitchers arrest as rod-like early larvae; rare escapers die as Vul adults. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Denise Clark Received: 12/03/97 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2013 Species: Caenorhabditis elegans Genotype: unc-22(s7) let-97(s1121) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, UncLet (Twitcher), Vul, and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: D. Clark Received: 12/12/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2020 Species: Caenorhabditis elegans Genotype: let-70(s1132) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, UncLet (twitchers) and dead eggs. Lethal early larval. Maintain by picking WT. See also WBPaper00002501. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Clark D Received: 01/14/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2021 Species: Caenorhabditis elegans Genotype: let-289(s1133) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed! Mutagen: EMS Outcrossed: x0 Reference: Made by: Denise Clark Received: 03/01/96 from Riddle D, Genome BC, Vancouver, BC, Canada -------------------- Strain: BC2024 Species: Caenorhabditis elegans Genotype: let-291(s1139) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed! Mutagen: EMS Outcrossed: x0 Reference: Made by: Denise Clark Received: 03/01/96 from Riddle D, Genome BC, Vancouver, BC, Canada -------------------- Strain: BC2029 Species: Caenorhabditis elegans Genotype: let-60(s1155) unc-22(s7) unc-31(e169) IV/nT1 (IV;V). Description: Heterozygotes are WT and segregate WT, Vul and Twitcher UncLethals. s1155 is viable; 14% Vul. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Denise Clark Received: 12/03/97 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2034 Species: Caenorhabditis elegans Genotype: let-292(s1146) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed! Mutagen: EMS Outcrossed: x0 Reference: Made by: Denise Clark Received: 03/01/96 from Riddle D, Genome BC, Vancouver, BC, Canada -------------------- Strain: BC2035 Species: Caenorhabditis elegans Genotype: unc-22(s7) unc-31(e169) let-317(s1153)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Egl, UncLet and dead eggs. Lethal at embryo-early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1303 Charest DL;Clark DV;Green ME;Baillie DL Genetic and fine-structure analysis of unc-26(IV) and adjacent regions in Caenorhabditis elegans. Molecular & General Genetics 221: 459-465 1990 Made by: Clark D Received: 08/27/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2036 Species: Caenorhabditis elegans Genotype: let-100(s1160) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: D. Clark Received: 12/12/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2037 Species: Caenorhabditis elegans Genotype: let-293(s1166) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are short and somewhat Egl. Offspring are short. Segregate Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Not outcrossed! Mutagen: EMS Outcrossed: x0 Reference: Made by: Denise Clark Received: 03/01/96 from Riddle D, Genome BC, Vancouver, BC, Canada -------------------- Strain: BC2047 Species: Caenorhabditis elegans Genotype: let-290(s1140) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed! Mutagen: EMS Outcrossed: x0 Reference: Made by: Denise Clark Received: 03/01/96 from Riddle D, Genome BC, Vancouver, BC, Canada -------------------- Strain: BC2049 Species: Caenorhabditis elegans Genotype: let-658(s1149) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, UncLet, Egl and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: Made by: D. Clark Received: 03/04/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2053 Species: Caenorhabditis elegans Genotype: let-307(s1171) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Egl, Lethal Twitchers and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: D. Clark Received: 12/12/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2060 Species: Caenorhabditis elegans Genotype: let-311(s1195) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal late larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: D. Clark Received: 12/12/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2061 Species: Caenorhabditis elegans Genotype: let-69(s1111) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Egl, Lethal Twitchers and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Clark D Received: 01/14/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2063 Species: Caenorhabditis elegans Genotype: unc-22(s7) let-309(s1115) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal late larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: D. Clark Received: 12/12/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2067 Species: Caenorhabditis elegans Genotype: let-659(s1152) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, UncLet, Egl and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: Made by: D. Clark Received: 03/04/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2069 Species: Caenorhabditis elegans Genotype: let-651(s1165) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, Lethals and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Clark D Received: 01/14/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2070 Species: Caenorhabditis elegans Genotype: let-294(s1103) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed! Mutagen: EMS Outcrossed: x0 Reference: Made by: Denise Clark Received: 03/01/96 from Riddle D, Genome BC, Vancouver, BC, Canada -------------------- Strain: BC2079 Species: Caenorhabditis elegans Genotype: unc-22(s7) unc-31(e169) let-301(s1134)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, UncLet, and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1303 Charest DL;Clark DV;Green ME;Baillie DL Genetic and fine-structure analysis of unc-26(IV) and adjacent regions in Caenorhabditis elegans. Molecular & General Genetics 221: 459-465 1990 Made by: Clark D Received: 08/30/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2088 Species: Caenorhabditis elegans Genotype: let-295(s1175) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed! Mutagen: EMS Outcrossed: x0 Reference: Made by: Denise Clark Received: 03/01/96 from Riddle D, Genome BC, Vancouver, BC, Canada -------------------- Strain: BC2094 Species: Caenorhabditis elegans Genotype: unc-22(s7) unc-31(e169) let-313(s1135)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, Sterile Unc, and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: Made by: Clark D Received: 10/14/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2105 Species: Caenorhabditis elegans Genotype: let-308(s1705) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Egl, Lethal Twitchers and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Denise Clark Received: 12/12/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2107 Species: Caenorhabditis elegans Genotype: unc-22(s7) unc-31(e169) let-314(s1206)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Egl, UncLet and dead eggs. Lethal at embryo-early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1303 Charest DL;Clark DV;Green ME;Baillie DL Genetic and fine-structure analysis of unc-26(IV) and adjacent regions in Caenorhabditis elegans. Molecular & General Genetics 221: 459-465 1990 Made by: Clark D Received: 01/14/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2113 Species: Caenorhabditis elegans Genotype: unc-22(s7) unc-31(e169) let-318(s1218)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, Sterile Uncs and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1303 Charest DL;Clark DV;Green ME;Baillie DL Genetic and fine-structure analysis of unc-26(IV) and adjacent regions in Caenorhabditis elegans. Molecular & General Genetics 221: 459-465 1990 Made by: Clark D Received: 02/10/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2120 Species: Caenorhabditis elegans Genotype: unc-22(s7) unc-31(e169) let-321(s1228)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Egl, Sterile Unc, and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1303 Charest DL;Clark DV;Green ME;Baillie DL Genetic and fine-structure analysis of unc-26(IV) and adjacent regions in Caenorhabditis elegans. Molecular & General Genetics 221: 459-465 1990 Made by: Clark D Received: 02/10/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2124 Species: Caenorhabditis elegans Genotype: unc-22(s7) unc-31(e169) let-322(s1238)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, UncLets and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1303 Charest DL;Clark DV;Green ME;Baillie DL Genetic and fine-structure analysis of unc-26(IV) and adjacent regions in Caenorhabditis elegans. Molecular & General Genetics 221: 459-465 1990 Made by: Clark D Received: 02/03/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2126 Species: Caenorhabditis elegans Genotype: let-657(s1254) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, UncLet, Vul and dead eggs. Maintain by picking twitchers (hets) in 1% nicotine. Mutagen: EMS Outcrossed: x Reference: Made by: D. Clark Received: 05/18/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2130 Species: Caenorhabditis elegans Genotype: unc-22(s7) unc-31(e169) let-316(s1227)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul and TwitcherUncLet. Lethal ??. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1303 Charest DL;Clark DV;Green ME;Baillie DL Genetic and fine-structure analysis of unc-26(IV) and adjacent regions in Caenorhabditis elegans. Molecular & General Genetics 221: 459-465 1990 Made by: Denise Clark Received: 09/02/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2137 Species: Caenorhabditis elegans Genotype: let-312(s1234) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal late larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Denise Clark Received: 12/12/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2144 Species: Caenorhabditis elegans Genotype: unc-22(s7) unc-31(e169) let-320(s1248)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul and UncLet. Homozygous s1248 is a sterile adult. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1303 Charest DL;Clark DV;Green ME;Baillie DL Genetic and fine-structure analysis of unc-26(IV) and adjacent regions in Caenorhabditis elegans. Molecular & General Genetics 221: 459-465 1990 Made by: D. Clark Received: 01/21/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2148 Species: Caenorhabditis elegans Genotype: let-296(s1250) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vuls, early-mid larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed! Mutagen: EMS Outcrossed: x0 Reference: Made by: Denise Clark Received: 03/01/96 from Riddle D, Genome BC, Vancouver, BC, Canada -------------------- Strain: BC2179 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; mDf3/eT1 V. Description: Heterozygotes are WT and segregate WT, dead eggs and Unc-36. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. [2/99: Strain may have broken down: doesn't segregate real WT, and those animals that are not Unc-36 still are somewhat Unc; and unc-23 is no longer under mDf3 in this strain. Mike Nonet] Mutagen: Outcrossed: x Reference: Made by: R. Rosenbluth Received: 03/01/87 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2200 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, dead eggs and DpyUncs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Outcrossed: x Reference: CGC #1071 Johnsen RC;Baillie DL Formaldehyde mutagenesis of the eT1 balanced region in C. elegans: Dose-response curve and the analysis of mutational events. Mutation Research 201: 137-147 1988 Made by: Johnsen RC Received: 12/18/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2237 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-348(s1436) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: R. Johnsen Received: 06/14/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2245 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-339(s1444)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, dead eggs and DpyUncLets. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Johnsen Received: 01/05/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2282 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) pst-1(s1481)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncs which arrest as embryos or as early larva and dead eggs. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Bob Johnsen Received: 04/12/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2303 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) unc-70(s1502)/eT1 V. Description: Heterozygotes are WT and segregate WT, Uncs and DpyUnc Lets that hatch. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: RC Johnsen Received: 07/03/03 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2383 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-469(s1582)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal as sterile adult. Maintain by picking WT. [7/94: No longer throwing eT1 Unc-36's. May have picked up a lethal mutation on one of the eT1 chromosomes. Also, appears to be lethal in mid-late larval stage rather than as adult.] Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 12/18/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2409 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1[dpy-?]III; let-331(s1608) unc-46(e177)/eT1[dpy-?]V. Description: Heterozygotes are WT and segregate WT, Unc-36???, Sterile DpyUncs, and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: Made by: Johnsen RC Received: 11/30/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2420 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-346(s1619)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, dead eggs and DpuUncLets. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 05/10/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2422 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-476(s1621)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet (Sterile adults) and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/16/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2440 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) unc-70(s1639)/eT1 V. Description: Heterozygotes are WT and segregate WT, Uncs, and DpyUnc Lets that hatch. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: RC Johnsen Received: 07/03/03 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2501 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) sDf57/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Co 60 Outcrossed: x1 Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Rosenbluth Received: 02/17/94 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2504 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-406(s514)/eT1 V. Description: WT strain that segregates WT, Unc-36, dead eggs and mid larval DpyUnc lethals. Maintain by picking WT. Mutagen: Gamma rays Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Rosenbluth Received: 01/19/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2507 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-60(e677) emb-29(s819) dpy-11(e224)/eT1 V. Description: WT strain which segregates WT, Unc-36, and dead eggs. Egg lethal. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Kim McKim Received: 01/19/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2509 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-408(s827)/eT1 V. Description: WT strain that segregates WT, Unc-36 and dead eggs. Egg lethal. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Kim McKim Received: 04/28/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2510 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-60(e677) let-426(s826) dpy-11(e224)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Kim McKim Received: 04/15/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2511 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) sDf35/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: EMS Outcrossed: x Reference: CGC #1018 McKim KS;Heschl MFP;Rosenbluth RE;Baillie DL Genetic organization of the unc-60 region in Caenorhabditis elegans. Genetics 118: 49-59 1988 Made by: Mark Heschl Received: 03/01/87 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2513 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; dpy-11(e224) let-407(s830)/eT1 V. Description: WT strain that segregates WT, Unc-36, dead eggs and DpyLets. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Kim McKim Received: 04/28/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2589 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; dpy-11(e224) let-405(s116)/eT1 V. Description: WT strain that segregates WT, Unc-36, dead eggs and DpyLets. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Rosenbluth Received: 04/15/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2590 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; dpy-11(e224) let-404(s119) unc-42(e270)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: T. Rogalski Received: 11/20/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2617 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; mDf1/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Outcrossed: x Reference: CGC #741 Waterston RH;Hirsh D;Lane TR Dominant mutations affecting muscle structure in C. elegans that map near the actin gene cluster. Journal of Molecular Biology 180: 473-496 1984 Made by: Rogalski/Rosenbluth Received: 03/01/87 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2628 Species: Caenorhabditis elegans Genotype: sDf7/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, lethals (early larval) and dead eggs. Hets twitch in 1% nicotine. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #592 Rogalski TM;Moerman DG;Baillie DL Essential genes and deficiencies in the unc-22 IV region of C. elegans. Genetics 102: 725-736 1982 Made by: D. Clark Received: 07/17/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2646 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-410(s815)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Kim McKim Received: 04/15/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2648 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-409(s823)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Kim McKim Received: 04/28/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2649 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; dpy-11(e224) let-337(s825)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Kim McKim Received: 04/15/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2650 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; dpy-11(e224) rol-3(s833)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, dead eggs, and DpyRol. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Kim McKim Received: 04/28/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2738 Species: Caenorhabditis elegans Genotype: sDf110 dpy-18(e364)/eT1 III; unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36s and dead eggs. Mutagen: UV Outcrossed: x Reference: Made by: Received: 08/13/99 from Rose A, University of British Columbia, Vancouver -------------------- Strain: BC2831 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-440(s1411) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLets and dead eggs. Lethal very early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 12/07/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2832 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-336(s1413) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 11/20/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2833 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-442(s1416)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early-mid larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 12/12/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2836 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-436(s1403)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 12/12/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2837 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-326(s1404) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, dead eggs and DpyUncLets. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 12/11/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2838 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-437(s1405) unc-46(e177)/eT1 V. Description: Heterozygotes are WT (abnormal tail on hermpahrodites) and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 12/16/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2840 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-439(s1407)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 12/16/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2841 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-441(s1414)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval--escapers at permissive temp(15C). Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 01/31/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2842 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-444(s1418)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 12/16/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2851 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-443(s1417)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, dead eggs and DpyUncLets. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 12/16/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2853 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-445(s1419)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet (Mel->larval lethal--tight coiler) and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 12/13/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2858 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-438(s2114)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Maintain by picking WT. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 12/17/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2890 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-411(s223)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal late larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Raja Rosenbluth Received: 01/19/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2892 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) air-1(s579)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet (Mel->egg lethal) and dead eggs. Maintain by picking WT. Previously called let-412(s579). See also WBPaper00005639. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Raja Rosenbluth Received: 01/19/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2895 Species: Caenorhabditis elegans Genotype: let-73(s685) unc-22(s7)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, Twitcher Steriles and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Clark D Received: 01/14/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2897 Species: Caenorhabditis elegans Genotype: let-72(s695) unc-22(s7)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, dead eggs, and UncLets. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #813 Rogalski TM;Baillie DL Genetic organization of the unc-22 IV gene and the adjacent region in C. elegans. Molecular & General Genetics 201: 409-414 1985 Made by: Teresa Rogalski Received: 01/05/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2898 Species: Caenorhabditis elegans Genotype: let-71(s692) unc-22(s7)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vuls and Lethal Twitchers (Late larval lethals). Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #813 Rogalski TM;Baillie DL Genetic organization of the unc-22 IV gene and the adjacent region in C. elegans. Molecular & General Genetics 201: 409-414 1985 Made by: Denise Clark Received: 09/15/97 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2903 Species: Caenorhabditis elegans Genotype: let-92(s504) unc-22(s7)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, dead eggs and UncLets. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #813 Rogalski TM;Baillie DL Genetic organization of the unc-22 IV gene and the adjacent region in C. elegans. Molecular & General Genetics 201: 409-414 1985 Made by: Dave Pilgrim Received: 01/05/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2907 Species: Caenorhabditis elegans Genotype: let-91(s678) unc-22(s7)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, mid-larval lethals that Twitch, Vuls and dead eggs. Mutagen: EMS Outcrossed: x Reference: CGC #1522 Clark DV;Baillie DL Genetic analysis and complementation by germ-line transformation of lethal mutations in the unc-22 IV region of Caenorhabditis elegans. Molecular & General Genetics 232: 97-105 1992 Made by: Denise Clark Received: 09/19/97 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2908 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-423(s818)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Kim McKim Received: 04/28/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2910 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-422(s194) dpy-11(e224) unc-42(e270)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Teresa Roglski Received: 01/19/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2991 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; dpy-11(e224) let-413(s128) unc-42(e270)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Egg lethal. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Teresa Rogalski Received: 01/19/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC2992 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; dpy-11(e224) let-409(s206)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Raja Rosenbluth Received: 12/01/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3005 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-424(s384)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncSterile adults and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Raja Rosenbluth Received: 12/01/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3006 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-330(s1702) unc-46(e177) let-427(s1057)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. let-427 is a sterile adult mutation. let-330 is a mid-larval mutation. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: R. Rosenbluth Received: 06/14/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3016 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; dpy-11(e224) let-416(s113) unc-42(e270)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Late larval lethal. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Teresa Rogalski Received: 12/01/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3017 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; dpy-11(e224) let-414(s114) unc-42(e270)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Teresa Rogalski Received: 12/01/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3019 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; dpy-11(e224) let-415(s129) unc-42(e270)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Mid-late larval lethal. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Teresa Rogalski Received: 12/01/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3020 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; dpy-11(e224) let-408(s195) unc-42(e270)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal late larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Teresa Rogalski Received: 12/01/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3021 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-417(s204) dpy-11(e224) unc-42(e270)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Teresa Rogalski Received: 12/01/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3033 Species: Caenorhabditis elegans Genotype: dpy-18(e346)/eT1 III; sDf48 unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: mut-4 Outcrossed: x Reference: CGC #1268 Clark DV;Johnsen RC;McKim KS;Baillie DL Analysis of lethal mutations induced in a mutator strain that activates transposable elements in Caenorhabditis elegans. Genome 33: 109-114 1990 Made by: Received: 12/09/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3038 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-448(s1363) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-late larval. Maintain by picking WT. Mutagen: Tc1 Outcrossed: x Reference: CGC #1268 Clark DV;Johnsen RC;McKim KS;Baillie DL Analysis of lethal mutations induced in a mutator strain that activates transposable elements in Caenorhabditis elegans. Genome 33: 109-114 1990 Made by: Clark & McKim Received: 12/17/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3041 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-449(s1343) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. [11/96: the strain is not throwing Unc-36 (eT1 homozygotes). eT1 may have picked up a lethal mutations which causes these animals to arrest, possibly as L1s.] Mutagen: Tc1 Outcrossed: x Reference: CGC #1268 Clark DV;Johnsen RC;McKim KS;Baillie DL Analysis of lethal mutations induced in a mutator strain that activates transposable elements in Caenorhabditis elegans. Genome 33: 109-114 1990 Made by: Clark & McKim Received: 12/17/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3060 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) mdt-6(s385)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncSte adults and dead eggs. Maintain by picking WT. See also WBPaper00004853. mdt-6 also called med-6 and let-425. See WBPaper00004990. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Raja Rosenbluth Received: 12/01/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3062 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-429(s584)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncSte adults and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Raja Rosenbluth Received: 12/01/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3075 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-452(s1434) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval (hatches). Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 12/18/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3076 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-337(s1426)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/11/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3083 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-454(s1423)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval; double cuticle, no pumping. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 05/10/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3085 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-453(s2167) let-417(s1424) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: R. Johnsen Received: 06/14/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3087 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-335(s1439)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 01/31/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3097 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-430(s1042) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncSte adults and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: R. Johnsen Received: 12/01/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3099 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-420(s1046) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncSte adult (vulva protrudes) and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Johnsen & Rosenbluth Received: 11/20/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3100 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-431(s1049) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncSte adult and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Johnsen & Rosenbluth Received: 11/27/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3106 Species: Caenorhabditis elegans Genotype: let-53(s43) unc-22(s7)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and throw WT, TwitcherLets, Vul and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #592 Rogalski TM;Moerman DG;Baillie DL Essential genes and deficiencies in the unc-22 IV region of C. elegans. Genetics 102: 725-736 1982 Made by: D. Clark Received: 12/09/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3107 Species: Caenorhabditis elegans Genotype: let-54(s44) unc-22(s7)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate more WT, Vul, and Lethal Twitchers. Lethal early larval. Heterozygotes twitch in 1% Nicotine. Mutagen: EMS Outcrossed: x Reference: CGC #592 Rogalski TM;Moerman DG;Baillie DL Essential genes and deficiencies in the unc-22 IV region of C. elegans. Genetics 102: 725-736 1982 Made by: Denise Clark Received: 04/30/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3119 Species: Caenorhabditis elegans Genotype: unc-5(e152) unc-22(s7) let-99(s1201) unc-31(e169)IV/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Egl, UncLet (maternal effect lethal) and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1040 Clark DV;Rogalski TM;Donati LM;Baillie DL The unc-22(IV) region of Caenorhabditis elegans: Genetic analysis of lethal mutations. Genetics 119: 345-353 1988 Made by: Denise Clark Received: 12/12/88 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3134 Species: Caenorhabditis elegans Genotype: srl-2(s2507) dpy-18(e364)III; unc-46(e177) rol-3(s1040)V. Description: srl-2 is a recessive suppressor of the s1040 temperature sensitive lethal phenotype. srl-2 has no effect on the Roller phenotype of s1040. (At 20C, s1040 homozygotes arrest development at mid-larval stage. At 15C, s1040 homozygotes are viable weak left-handed rollers.) Maintain at 20C to select for retention of suppressor. Animals at 20C will be DpyUncRol. Mutagen: EMS Outcrossed: x Reference: CGC #1853 Barbazuk WB;Johnsen RC;Baillie DL The generation and genetic analysis of suppressors of lethal mutations in the Caenorhabditis elegans rol-3(V) gene. Genetics 136: 129-143 1994 Made by: W. B. Barbazuk Received: 02/17/94 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3150 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-338(s1020) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Johnsen & Rosenbluth Received: 11/27/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3199 Species: Caenorhabditis elegans Genotype: sDf60 IV/nT1(IV;V). Description: Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1303 Charest DL;Clark DV;Green ME;Baillie DL Genetic and fine-structure analysis of unc-26(IV) and adjacent regions in Caenorhabditis elegans. Molecular & General Genetics 221: 459-465 1990 Made by: Clark D Received: 01/11/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3217 Species: Caenorhabditis elegans Genotype: unc-60(m35) dpy-11(e224)V; sDp30(V;X). Description: Unc strain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma Rays Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Raja Rosenbluth Received: 12/01/89 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3247 Species: Caenorhabditis elegans Genotype: unc-22(s7) unc-31(e169) let-323(s1719)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul and UncLet. Homozygous s1719 are sterile adults. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1303 Charest DL;Clark DV;Green ME;Baillie DL Genetic and fine-structure analysis of unc-26(IV) and adjacent regions in Caenorhabditis elegans. Molecular & General Genetics 221: 459-465 1990 Made by: D. Clark Received: 01/21/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3255 Species: Caenorhabditis elegans Genotype: unc-22(s7) unc-31(e169) let-324(s1727)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, UncLets and dead eggs. UncLets die in early larval development. Maintain by picking Twitchers in 1% nicotine. Mutagen: EMS Outcrossed: x Reference: CGC #1303 Charest DL;Clark DV;Green ME;Baillie DL Genetic and fine-structure analysis of unc-26(IV) and adjacent regions in Caenorhabditis elegans. Molecular & General Genetics 221: 459-465 1990 Made by: D.V. Clark Received: 02/03/94 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3261 Species: Caenorhabditis elegans Genotype: let-653(s1733) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Early larval arrest (L1-L2). Maintain by picking WT. See also WBPaper00002328 and WBPaper00003721. Mutagen: EMS Outcrossed: x Reference: CGC #1522 Clark DV;Baillie DL Genetic analysis and complementation by germ-line transformation of lethal mutations in the unc-22 IV region of Caenorhabditis elegans. Molecular & General Genetics 232: 97-105 1992 Made by: Clark D Received: 01/14/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3266 Species: Caenorhabditis elegans Genotype: unc-22(s7) unc-31(e169) let-325(s1738)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul and dead eggs. Mutagen: EMS Outcrossed: x Reference: CGC #1303 Charest DL;Clark DV;Green ME;Baillie DL Genetic and fine-structure analysis of unc-26(IV) and adjacent regions in Caenorhabditis elegans. Molecular & General Genetics 221: 459-465 1990 Made by: Diana Collins Received: 07/09/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3276 Species: Caenorhabditis elegans Genotype: let-655(s1748) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, UncLet (Sterile) and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1522 Clark DV;Baillie DL Genetic analysis and complementation by germ-line transformation of lethal mutations in the unc-22 IV region of Caenorhabditis elegans. Molecular & General Genetics 232: 97-105 1992 Made by: Clark D Received: 01/14/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3282 Species: Caenorhabditis elegans Genotype: unc-22(s7) unc-31(e169) let-319(s1754)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul and UncLet. Lethal late larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1303 Charest DL;Clark DV;Green ME;Baillie DL Genetic and fine-structure analysis of unc-26(IV) and adjacent regions in Caenorhabditis elegans. Molecular & General Genetics 221: 459-465 1990 Made by: D. Clark Received: 01/21/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3295 Species: Caenorhabditis elegans Genotype: unc-22(s7) let-656(s1767) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul and TwitcherLetUnc. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: Made by: Denise Clark Received: 09/02/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3303 Species: Caenorhabditis elegans Genotype: egl-38(s1775) unc-22(s7) unc-31(e169) IV/nT1 (IV;V) Description: s1775 homozygotes die as embryos or L1 larvae. Heterozygous animals are WT and segregate WT, Twitcher lethals and dead eggs. nT1 appears to have a lethal mutation. Mutagen: Outcrossed: x Reference: CGC #2924 Chamberlin HM;Palmer RE;Newman AP;Sternberg PW;Baillie DL;Thomas JH The PAX gene egl-38 mediates developmental patterning in Caenorhabditis elegans. Development 124: 3919-3928 1997 Made by: Received: 12/12/97 from Thomas J, University of Washington, Seattle -------------------- Strain: BC3315 Species: Caenorhabditis elegans Genotype: sDf61 unc-31(e169) IV/nT1[let-?(m435)] (IV;V). Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1522 Clark DV;Baillie DL Genetic analysis and complementation by germ-line transformation of lethal mutations in the unc-22 IV region of Caenorhabditis elegans. Molecular & General Genetics 232: 97-105 1992 Made by: Clark D Received: 01/14/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3316 Species: Caenorhabditis elegans Genotype: sDf62 unc-31(e169) IV/nT1[let-?(m435)] (IV;V). Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1522 Clark DV;Baillie DL Genetic analysis and complementation by germ-line transformation of lethal mutations in the unc-22 IV region of Caenorhabditis elegans. Molecular & General Genetics 232: 97-105 1992 Made by: Clark D Received: 01/14/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3317 Species: Caenorhabditis elegans Genotype: sDf63 unc-31(e169) IV/nT1[let-?(m435)] (IV;V). Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1522 Clark DV;Baillie DL Genetic analysis and complementation by germ-line transformation of lethal mutations in the unc-22 IV region of Caenorhabditis elegans. Molecular & General Genetics 232: 97-105 1992 Made by: Clark D Received: 02/03/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3318 Species: Caenorhabditis elegans Genotype: sDf64 unc-31(e169) IV/nT1[let-?(m435)] (IV;V). Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1522 Clark DV;Baillie DL Genetic analysis and complementation by germ-line transformation of lethal mutations in the unc-22 IV region of Caenorhabditis elegans. Molecular & General Genetics 232: 97-105 1992 Made by: Clark D Received: 02/03/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3319 Species: Caenorhabditis elegans Genotype: sDf65 unc-31(e169) IV/nT1[let-?(m435)] (IV;V). Description: Heterozygotes are WT and segregate WT, lethal Uncs (arrest as L1) and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1522 Clark DV;Baillie DL Genetic analysis and complementation by germ-line transformation of lethal mutations in the unc-22 IV region of Caenorhabditis elegans. Molecular & General Genetics 232: 97-105 1992 Made by: Clark D Received: 01/14/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3320 Species: Caenorhabditis elegans Genotype: sDf67 unc-31(e169) IV/nT1[let-?(m435)] (IV;V). Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1522 Clark DV;Baillie DL Genetic analysis and complementation by germ-line transformation of lethal mutations in the unc-22 IV region of Caenorhabditis elegans. Molecular & General Genetics 232: 97-105 1992 Made by: Clark D Received: 01/14/92 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3401 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf42 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT, dead eggs, no DpyUnc-46, and no Unc-36. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1071 Johnsen RC;Baillie DL Formaldehyde mutagenesis of the eT1 balanced region in C. elegans: Dose-response curve and the analysis of mutational events. Mutation Research 201: 137-147 1988 Made by: Johnsen RC Received: 11/20/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3402 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf32 unc-46(e177)/eT1[let-500(s2165)] V. Description: Heterozygotes are WT and segregate WT, dead eggs and early larval lethals (sDf32 homozygotes). This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: EMS Outcrossed: x Reference: CGC #1018 McKim KS;Heschl MFP;Rosenbluth RE;Baillie DL Genetic organization of the unc-60 region in Caenorhabditis elegans. Genetics 118: 49-59 1988 Made by: Rosenbluth Received: 05/23/94 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3413 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-455(s1447) unc-46(e177)/eT1 V. Description: Heterozygottes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 01/31/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3415 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-456(s1479)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 01/23/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3421 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-458(s1443) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 01/23/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3425 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-460(s1664)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 01/23/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3426 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-459(s1432) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 01/31/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3427 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-409(s1480)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval (hatches-tends to curl). Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/11/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3430 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-421(s1477)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, and dead eggs. Egg lethal. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 01/31/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3436 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf33 unc-46(e177)/eT1[let-500(s2165)] V. Description: Heterozygotes are WT (some seem to look a bit Dpyish) and segregate WT and dead eggs. sDf33 homozygotes arrest as embryos. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma Rays Outcrossed: x Reference: CGC #1018 McKim KS;Heschl MFP;Rosenbluth RE;Baillie DL Genetic organization of the unc-60 region in Caenorhabditis elegans. Genetics 118: 49-59 1988 Made by: Johnsen Received: 05/23/94 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3439 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf26/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma rays Outcrossed: x Reference: CGC #750 Rosenbluth RE;Cuddeford C;Baillie DL Mutagenesis in Caenorhabditis elegans. II. A spectrum of mutational events induced with 1500 R of gamma-radiation. Genetics 109: 493-511 1985 Made by: R. Johnsen Received: 06/29/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3443 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf46 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT, dead eggs, no DpyUnc-46, and no Unc-36. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1071 Johnsen RC;Baillie DL Formaldehyde mutagenesis of the eT1 balanced region in C. elegans: Dose-response curve and the analysis of mutational events. Mutation Research 201: 137-147 1988 Made by: Johnsen RC Received: 12/13/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3444 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-419(s1483) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early-mid larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 01/31/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3448 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-428(s1490) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal late larval-Extrudes viscera. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 01/31/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3450 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-403(s1482)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 01/31/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3452 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-463(s2168) rol-3(s1473)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 01/31/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3453 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-464(s1504)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 01/31/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3455 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; lin-40(s1506) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Mid-larval lethal. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 11/15/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3458 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-447(s1457) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet adults (Mel (egg lethal)) and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/11/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3461 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf53 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1071 Johnsen RC;Baillie DL Formaldehyde mutagenesis of the eT1 balanced region in C. elegans: Dose-response curve and the analysis of mutational events. Mutation Research 201: 137-147 1988 Made by: Johnsen RC Received: 12/07/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3462 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf39 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma Rays Outcrossed: x Reference: CGC #1252 Rosenbluth RE;Johnsen RC;Baillie DL Pairing for recombination in LG V of Caenorhabditis elegans: A model based on recombination in deficiency heterozygotes. Genetics 124: 615-625 1990 Made by: Johnsen RC Received: 11/20/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3463 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf38 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma rays Outcrossed: x Reference: CGC #1252 Rosenbluth RE;Johnsen RC;Baillie DL Pairing for recombination in LG V of Caenorhabditis elegans: A model based on recombination in deficiency heterozygotes. Genetics 124: 615-625 1990 Made by: Johnsen RC Received: 11/27/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3464 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) sDf20/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma rays Outcrossed: x Reference: Made by: R. Johnsen Received: 06/29/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3466 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) sDf30/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma rays Outcrossed: x Reference: Made by: Johnsen/Rosenbluth Received: 06/29/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3468 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) sDf36/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: No mutagen used Outcrossed: x Reference: CGC #1071 Johnsen RC;Baillie DL Formaldehyde mutagenesis of the eT1 balanced region in C. elegans: Dose-response curve and the analysis of mutational events. Mutation Research 201: 137-147 1988 Made by: Rosenbluth/Johnsen Received: 06/29/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3469 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) sDf37/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma rays Outcrossed: x Reference: CGC #1108 Rosenbluth RE;Rogalski TM;Johnsen RC;Addison LM;Baillie DL Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V(left). Genetical Research 52: 105-118 1988 Made by: Johnsen RC Received: 11/27/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3470 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf40 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: mut-4 Outcrossed: x Reference: CGC #1268 Clark DV;Johnsen RC;McKim KS;Baillie DL Analysis of lethal mutations induced in a mutator strain that activates transposable elements in Caenorhabditis elegans. Genome 33: 109-114 1990 Made by: Johnsen RC Received: 12/10/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3471 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf41 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT, dead eggs, and no Unc-36 or DpyUnc-46. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: mut-4 Outcrossed: x Reference: CGC #1268 Clark DV;Johnsen RC;McKim KS;Baillie DL Analysis of lethal mutations induced in a mutator strain that activates transposable elements in Caenorhabditis elegans. Genome 33: 109-114 1990 Made by: Johnsen RC Received: 11/29/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3472 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) sDf44/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1071 Johnsen RC;Baillie DL Formaldehyde mutagenesis of the eT1 balanced region in C. elegans: Dose-response curve and the analysis of mutational events. Mutation Research 201: 137-147 1988 Made by: Johnsen RC Received: 11/29/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3473 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf45 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: mut-4 Outcrossed: x Reference: CGC #1268 Clark DV;Johnsen RC;McKim KS;Baillie DL Analysis of lethal mutations induced in a mutator strain that activates transposable elements in Caenorhabditis elegans. Genome 33: 109-114 1990 Made by: Johnsen RC Received: 12/04/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3474 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) sDf47/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1071 Johnsen RC;Baillie DL Formaldehyde mutagenesis of the eT1 balanced region in C. elegans: Dose-response curve and the analysis of mutational events. Mutation Research 201: 137-147 1988 Made by: Johnsen RC Received: 11/30/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3476 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf49 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: mut-4 Outcrossed: x Reference: CGC #1268 Clark DV;Johnsen RC;McKim KS;Baillie DL Analysis of lethal mutations induced in a mutator strain that activates transposable elements in Caenorhabditis elegans. Genome 33: 109-114 1990 Made by: Johnsen RC Received: 12/04/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3499 Species: Caenorhabditis elegans Genotype: let-297(s1989) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed! Mutagen: EMS Outcrossed: x0 Reference: Made by: Denise Clark Received: 03/01/96 from Riddle D, Genome BC, Vancouver, BC, Canada -------------------- Strain: BC3539 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf50 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1071 Johnsen RC;Baillie DL Formaldehyde mutagenesis of the eT1 balanced region in C. elegans: Dose-response curve and the analysis of mutational events. Mutation Research 201: 137-147 1988 Made by: Johnsen RC Received: 11/20/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3540 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf51 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT, dead eggs, and no Unc-36 or DpyUnc-46. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: mut-4 Outcrossed: x Reference: Made by: Johnsen RC Received: 12/13/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3541 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf52 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: mut-4 Outcrossed: x Reference: CGC #1268 Clark DV;Johnsen RC;McKim KS;Baillie DL Analysis of lethal mutations induced in a mutator strain that activates transposable elements in Caenorhabditis elegans. Genome 33: 109-114 1990 Made by: Johnsen RC Received: 12/03/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3543 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; nDf18/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Outcrossed: x Reference: CGC #1018 McKim KS;Heschl MFP;Rosenbluth RE;Baillie DL Genetic organization of the unc-60 region in Caenorhabditis elegans. Genetics 118: 49-59 1988 Made by: Received: 06/29/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3551 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-426(s1527) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 01/31/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3555 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-467(s1521)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval (hatches). Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 01/31/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3557 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-340(s1508)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/11/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3559 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-415(s1525) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/11/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3564 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-327(s1496) unc-46(e177)/eT1 V. Description: Hets are Slow, have Morphological Abnormalities, and are lethal at 25C. Segregate hets, Unc-36 dead eggs, and DpyUncLet. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/11/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3581 Species: Caenorhabditis elegans Genotype: eT1 unc-60(s1331)III; eT1 V. Description: Unc-paralysed. Both Unc-60 and Unc-36. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Outcrossed: x Reference: Made by: Raja Rosenbluth Received: 07/16/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3590 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-433(s950)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUnc sterile adults and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: Made by: H. Stewart Received: 02/17/94 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3592 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-434(s1904)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUnc sterile adults and dead eggs. Maintain by picking WT. Mutagen: Gamma Rays Outcrossed: x Reference: Made by: H. Stewart Received: 02/17/94 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3655 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-468(s1533)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/11/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3670 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; lag-2(s1486) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval, mid-larval at 15C. Maintain by picking WT. Previously called let-461(s1486). Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/11/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3672 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-471(s1570)/eT1 V. Description: Heterozygotes are WT and segregate WT, Uncs and lethal DpyUncs (mel -> early larval lethal). CGC received new stock 3/01. Not throwing eT1 homozygotes - possibly eT1 picked up a lethal mutation. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Bob Johnsen Received: 09/07/99 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3674 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-470(s1581)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/11/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3684 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-472(s1605)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/12/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3698 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-411(s1595)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/19/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3700 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) pst-1(s1594)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal embryo to early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/11/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3702 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-402(s1526)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/11/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3712 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-474(s1577)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/11/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3713 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-473(s1602)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. [This strain is acting strangely: it is throwing bent heads. 12/95] Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/12/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3716 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-475(s1606)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet (Sterile adult) and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/20/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3718 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-407(s1631)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval (hatches). Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/16/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3727 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf56 unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: EMS Outcrossed: x Reference: CGC #1912 McKim KS;Matheson C;Marra MA;Wakarchuk MF;Baillie DL The Caenorhabditis elegans unc-60 gene encodes proteins homologous to a family of actin-binding proteins. Molecular & General Genetics 242: 346-357 1994 Made by: Johnsen RC Received: 02/19/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3728 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-480(s1607)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet (Sterile adult) and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 05/10/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3729 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-478(s1620) let-?(s2169) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/18/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3731 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-479(s1576)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet (Sterile adult-> Lays unfertilized eggs) and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/18/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3732 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) let-418(s1617)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet (Sterile adult; Vulva protrudes; partial rescue at 15C) and dead eggs. Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/18/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3733 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-481(s1636) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval (hatches). Maintain by picking WT. Mutagen: EMS Outcrossed: x Reference: CGC #1474 Johnsen RC;Baillie DL Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129: 735-752 1991 Made by: Johnsen RC Received: 02/27/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3737 Species: Caenorhabditis elegans Genotype: sDp8(III;I); eT1(III;V). Description: WT strain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Outcrossed: x Reference: CGC #1425 Stewart HI;Rosenbluth RE;Baillie DL Most ultraviolet irradiation induced mutations in the nematode Caenorhabditis elegans are chromosomal rearrangements. Mutation Research 249: 37-54 1991 Made by: Stewart H Received: 05/10/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3840 Species: Caenorhabditis elegans Genotype: sDf69(s2298) unc-22(s7) lev-1(x22)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul and dead eggs. Hets twitch in 1% nicotine. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: EMS Outcrossed: x Reference: Made by: Marco Marra Received: 05/27/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3953 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf70 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT, no Unc36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: UV Outcrossed: x Reference: CGC #1425 Stewart HI;Rosenbluth RE;Baillie DL Most ultraviolet irradiation induced mutations in the nematode Caenorhabditis elegans are chromosomal rearrangements. Mutation Research 249: 37-54 1991 Made by: Stewart H Received: 10/15/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3954 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) sDf71/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. Embryonic lethal. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: UV Outcrossed: x Reference: CGC #1425 Stewart HI;Rosenbluth RE;Baillie DL Most ultraviolet irradiation induced mutations in the nematode Caenorhabditis elegans are chromosomal rearrangements. Mutation Research 249: 37-54 1991 Made by: Stewart H Received: 10/15/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3955 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf72 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. Embryonic lethal. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: UV Outcrossed: x Reference: CGC #1425 Stewart HI;Rosenbluth RE;Baillie DL Most ultraviolet irradiation induced mutations in the nematode Caenorhabditis elegans are chromosomal rearrangements. Mutation Research 249: 37-54 1991 Made by: Stewart H Received: 10/15/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3956 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf73 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT, dead eggs, no Unc-36, and DpyUncLet. Lethal early larva. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: UV Outcrossed: x Reference: CGC #1425 Stewart HI;Rosenbluth RE;Baillie DL Most ultraviolet irradiation induced mutations in the nematode Caenorhabditis elegans are chromosomal rearrangements. Mutation Research 249: 37-54 1991 Made by: Stewart H Received: 04/29/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3957 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf74 unc-46(e177)/eT1[let-500(s2165)]V. Description: WT strain which segregates WT and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: UV Outcrossed: x Reference: CGC #1425 Stewart HI;Rosenbluth RE;Baillie DL Most ultraviolet irradiation induced mutations in the nematode Caenorhabditis elegans are chromosomal rearrangements. Mutation Research 249: 37-54 1991 Made by: Stewart H Received: 10/15/90 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3958 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf75 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. Embryonic lethal. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: UV Outcrossed: x Reference: CGC #1425 Stewart HI;Rosenbluth RE;Baillie DL Most ultraviolet irradiation induced mutations in the nematode Caenorhabditis elegans are chromosomal rearrangements. Mutation Research 249: 37-54 1991 Made by: Stewart H Received: 04/29/91 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC3972 Species: Caenorhabditis elegans Genotype: srl-2(s2508) dpy-18(e354) III. Description: Dpy. Mutagen: EMS Outcrossed: x Reference: CGC #1853 Barbazuk WB;Johnsen RC;Baillie DL The generation and genetic analysis of suppressors of lethal mutations in the Caenorhabditis elegans rol-3(V) gene. Genetics 136: 129-143 1994 Made by: W. B. Barbazuk Received: 04/12/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4006 Species: Caenorhabditis elegans Genotype: sDf83 IV/nT1[let-?(m435)] (IV;V). Description: sDf83 homozygotes arrest as late larva or sterile adults after 2 weeks. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1891 Schein JE;Marra MA;Benian GM;Fields C;Baillie DL The use of deficiencies to determine essential gene content in the let-56 - unc-22 region of Caenorhabditis elegans. Genome 36: 1148-1156 1993 Made by: J. Schein Received: 09/05/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4008 Species: Caenorhabditis elegans Genotype: sDf85(s2089) IV/nT1[let-?(m435)] (IV;V). Description: Heterozygotes are WT and segregate WT and dead eggs. sDf85 homozygotes arrest as embryos or early L1 larva. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Formaldehyde Outcrossed: x Reference: Made by: J. Schein Received: 05/27/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4011 Species: Caenorhabditis elegans Genotype: srl-1(s2500)II; dpy-18(e364)III; unc-46(e177) rol-3(s1040)V. Description: srl-1 is a recessive suppressor of the s1040 temperature sensitive lethal phenotype. srl-1 has no effect on the Roller phenotype of s1040. (At 20C, s1040 homozygotes arrest development at mid-larval stage. At 15C, s1040 homozygotes are viable weak left-handed rollers.) Maintain at 20C to select for retention of suppressor. Animals at 20C will be DpyUncRol. Mutagen: Gamma rays Outcrossed: x1 Reference: CGC #1853 Barbazuk WB;Johnsen RC;Baillie DL The generation and genetic analysis of suppressors of lethal mutations in the Caenorhabditis elegans rol-3(V) gene. Genetics 136: 129-143 1994 Made by: W. B. Barbazuk Received: 02/17/94 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4095 Species: Caenorhabditis elegans Genotype: sDf88(s2074) IV. Description: PCR used to establish that s2074 is a deletion. Twitcher. Mutagen: Formaldehyde Outcrossed: x Reference: CGC #1891 Schein JE;Marra MA;Benian GM;Fields C;Baillie DL The use of deficiencies to determine essential gene content in the let-56 - unc-22 region of Caenorhabditis elegans. Genome 36: 1148-1156 1993 Made by: J. Schein Received: 03/09/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4142 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-769(s2432) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in mid to late larval development. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 08/07/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4143 Species: Caenorhabditis elegans Genotype: dpy-17(e164) mup-4(s2433) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development. s2433 previously assigned to let-701. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell & Stewart Received: 06/28/99 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4144 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-723(s2434) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and Sterile as adults. Mutagen: EMS Outcrossed: x Reference: Made by: Howell & Stewart Received: 04/23/03 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4145 Species: Caenorhabditis elegans Genotype: let-738(s2435) dpy-17(e164) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication arrest as embryos. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell and Stewart Received: 10/06/99 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4148 Species: Caenorhabditis elegans Genotype: dpy-17(e164) mel-31(s2438) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and give only dead eggs. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 09/05/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4149 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-712(s2439) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs arrest as early larvae. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 11/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4151 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-972(s2441) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs arrest at early larvae. s2441 previously assigned to let-703. Mutagen: EMS Outcrossed: x Reference: Made by: Howell/Stewart Received: 11/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4152 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-771(s2442) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as Sterile Adults. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A. Howell Received: 07/13/99 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4153 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-764(s2443) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as early larva. s2443 pka let-708. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 08/07/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4154 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-709(s2444) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs die as embryos. This is a slow developing strain. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 06/12/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4155 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-718(s2445) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs arrest as early larvae. This is a slow developing strain. Received new stock 9/03. 3/09: Buelow lab reported not seeing lethal DpyUncs. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 06/12/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4156 Species: Caenorhabditis elegans Genotype: let-750(s2446) dpy-17(e164) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs arrest as early larvae. This is a slow developing strain. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 11/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4157 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-721(s2447) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUncs and are sterile adults. Mutagen: EMS Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Howell/Stewart Received: 09/16/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4159 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-713(s2449) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUncs and arrest at the mid-larval stage of development. Mutagen: EMS Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Howell/Stewart Received: 09/16/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4163 Species: Caenorhabditis elegans Genotype: let-776(s2453) dpy-17(e164) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest at a mid-larval stage of development. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 05/12/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4164 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-725(s2454) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUncs and are sterile adults (some lay eggs that don't hatch). Mutagen: EMS Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Howell/Stewart Received: 09/16/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4165 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-719(s2455) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as Sterile Adults. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A. Howell Received: 07/13/99 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4166 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-747(s2456) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs arrest at early to mid larval stage. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 11/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4167 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-716(s2457) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUncs which arrest at an early larval stage. Mutagen: EMS Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Howell/Stewart Received: 09/16/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4168 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-704(s2458) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in mid-late larval development. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell & Stewart Received: 06/28/99 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4171 Species: Caenorhabditis elegans Genotype: let-761(s2461) dpy-17(e164) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs arrest at an early larval stage. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 11/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4172 Species: Caenorhabditis elegans Genotype: let-707(s2462) dpy-17(e164) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest at the early larval stage. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A. Howell Received: 03/02/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4173 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-766(s2463) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as early larva. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 08/07/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4179 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-777(s2469) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and become sterile adults. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 04/12/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4181 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-717(s2471) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs arrest as early larvae. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 06/12/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4185 Species: Caenorhabditis elegans Genotype: let-763(s2475) dpy-17(e164) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 08/07/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4186 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-741(s2476) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs arrest at early to mid larval stage. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 11/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4187 Species: Caenorhabditis elegans Genotype: let-737(s2477) dpy-17(e164) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs arrest as early larvae. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 06/12/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4188 Species: Caenorhabditis elegans Genotype: let-700(s2478) dpy-17(e164) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest at an early larval stage. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 04/16/01 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4190 Species: Caenorhabditis elegans Genotype: let-706(s2480) dpy-17(e164) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest at an early larval stage. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 05/12/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4192 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-768(s2482) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as sterile adults. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell & Stewart Received: 06/28/99 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4212 Species: Caenorhabditis elegans Genotype: let-710(s2572) dpy-17(e164) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest at an early larval stage, but s2572 is leaky. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 04/16/01 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4213 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-728(s2573) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs arrest at early-mid larval stage. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 11/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4216 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-780(s2576) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as Sterile Adults. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A. Howell Received: 07/13/99 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4218 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-748(s2578) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A. Howell Received: 07/13/99 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4219 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-729(s2579) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and are embyronic lethals. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 04/16/01 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4222 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-714(s2582) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs arrest as early larvae. s2582 previously thought to be an allele of let-726. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 06/12/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4224 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-778(s2584) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest at the early larval stage. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A. Howell Received: 03/02/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4225 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-786(s2585) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in the early larval stage. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 09/05/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4227 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-711(s2587) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs arrest as early larvae. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 06/12/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4229 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-727(s2589) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest at an early larval stage. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 04/16/01 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4231 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-782(s2591) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs become sterile adults. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 11/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4233 Species: Caenorhabditis elegans Genotype: let-739(s2593) dpy-17(e164) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs arrest at early-mid larval stage. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 11/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4235 Species: Caenorhabditis elegans Genotype: let-759(s2595) dpy-17(e164) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as late larvae or sterile adults. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 08/14/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4237 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-844(s2597) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs arrest at early larval stage. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 11/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4241 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-783(s2601) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and are probably embyronic lethals. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 04/16/01 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4242 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-784(s2602) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs become sterile adults. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 11/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4243 Species: Caenorhabditis elegans Genotype: let-760(s2603) dpy-17(e164) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in late larval development. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 08/07/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4245 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-753(s2605) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs arrest at early larval stage. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 11/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4246 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-789(s2606) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and become sterile adults. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A. Howell Received: 03/02/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4247 Species: Caenorhabditis elegans Genotype: let-758(s2607) dpy-17(e164) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc are adult steriles. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 08/07/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4249 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-746(s2609) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval stages. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell & Stewart Received: 06/28/99 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4253 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-756(s2613) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUncs which arrest as early larvae. Mutagen: EMS Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Howell/Stewart Received: 09/16/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4255 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-774(s2615) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUncs which arrest as early larvae. Mutagen: EMS Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Howell/Stewart Received: 09/16/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4256 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-764(s2616) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest at the early larval stage. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A. Howell Received: 03/02/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4258 Species: Caenorhabditis elegans Genotype: let-715(s2618) dpy-17(e164) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs become sterile adults. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 11/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4259 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-752(s2619) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as sterile adults. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell & Stewart Received: 06/28/99 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4261 Species: Caenorhabditis elegans Genotype: let-733(s2621) dpy-17(e164) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as Sterile Adults. Note: let-733(s2621) seems to interact with let-749(s2467). Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A. Howell Received: 07/13/99 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4262 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-754(s2622) unc-32(e189) III; sDp3(III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in mid larval development. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A.M. Howell Received: 08/07/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4267 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-843(s2627) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. After 3 days at 20C the DpyUncs are at the mid-larvae stage; by day 10 they are adults giving some eggs which hatch sick looking larvae. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 11/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4270 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-765(s2630) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. DpyUncs arrest at mid-larval stage. s2630 pka let-745. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Received: 11/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4271 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-786(s2631) unc-32(e189) III; sDp3 (III;f). Description: Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest at the early larval stage. s2631 previously thought to be an allele of let-731. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A. Howell Received: 03/02/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4279 Species: Caenorhabditis elegans Genotype: sC1(s2023)[dpy-1(s2170)] III. Description: Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: EMS Outcrossed: x Reference: Made by: A.M. Howell Received: 05/27/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4289 Species: Caenorhabditis elegans Genotype: sDp10 (IV;X). Description: Mutagen: Gamma Rays Outcrossed: x Reference: CGC #2024 Marra MA;Baillie DL Recovery of duplications by drug resistance selection in Caenorhabditis elegans. Genome 37: 701-705 1994 Made by: M.A. Marra Received: 09/05/00 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4390 Species: Caenorhabditis elegans Genotype: sEx776. Description: sEx776 [C05A2 (V) + pCes1943[rol-6(su1006)]]. "Low" amount of cosmid C05A2 + 100 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: The Ha Received: 04/15/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4425 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf48 unc-46(e177)/eT1[let-500(s2165)]V. Description: Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: mut-4 Outcrossed: x Reference: Made by: D. Clark Received: 03/04/93 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4542 Species: Caenorhabditis elegans Genotype: sEx29 [ZK652 (III) + pCes1943[rol-6(su1006)]]. Description: sEx29 [ZK652 (III) + pCes1943[rol-6(su1006)]]. Cosmid ZK652 and plasmid pCes1943 were injected into hermaphrodite from N2 strain. pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/30/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4544 Species: Caenorhabditis elegans Genotype: sEx31 [ZK688 (III) + pCes1943[rol-6(su1006)]]. Description: sEx31 [ZK688 (III) + pCes1943[rol-6(su1006)]]. Cosmid ZK688 and plasmid pCes1943 were injected into hermaphrodite from N2 strain. pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collin Received: 01/30/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4545 Species: Caenorhabditis elegans Genotype: sEx32 [T20H4 (III) + pCes1943[rol-6(su1006)]]. Description: sEx32 [T20H4 (III) + pCes1943[rol-6(su1006)]]. T20H4 + pCes1943[rol-6(su1006dm)] injected into N2 hermaphrodite. pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4566 Species: Caenorhabditis elegans Genotype: sEx34 [T21D11 (III) + pCes1943[rol-6(su1006)]]. Description: sEx34 [T21D11 (III) + pCes1943[rol-6(su1006)]]. Cosmid T21D11 + pCes1943[rol-6(su1006dm)] injected into N2 hermaphrodite. pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4583 Species: Caenorhabditis elegans Genotype: sEx37 [C06G4 (III) + pCes1943[rol-6(su1006)]]. Description: sEx37 [C06G4 (III) + pCes1943[rol-6(su1006)]]. Cosmid C06G4 and plasmid pCes1943 were injected into hermaphrodite from N2 strain. pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/30/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4585 Species: Caenorhabditis elegans Genotype: sEx39 [K06H7 (III) + pCes1943[rol-6(su1006)]]. Description: sEx39 [K06H7 (III) + pCes1943[rol-6(su1006)]]. Cosmid K06H7 and plasmid pCes1943 were injected into hermaphrodite from N2 strain. pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/30/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4586 Species: Caenorhabditis elegans Genotype: unc-76(e911) rol-9(sc148)/sC4(s2172)[dpy-21(e428)] V. Description: Heterozygotes are WT and segregate WT and Unc Rollers. sC4(s2172) is not viable as a homozygote. As a heterozygote it reduces recombination between unc-76 and rol-9 to 1.8%. Mutagen: Gamma Rays Outcrossed: x Reference: Made by: Helen Stewart Received: 12/10/01 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4604 Species: Caenorhabditis elegans Genotype: sEx50 [F44B9 (III) + pCes1943[rol-6(su1006)]]. Description: sEx50 [F44B9 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul F44B9 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4634 Species: Caenorhabditis elegans Genotype: dpy-17(e164) sDf125(s2424) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Unc-32 animals. Mutagen: UV Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Helen Stewart Received: 08/31/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4637 Species: Caenorhabditis elegans Genotype: sDf130(s2427) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Unc-32 animals. Mutagen: UV Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Helen Stewart Received: 08/31/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4638 Species: Caenorhabditis elegans Genotype: dpy-17(e164) sDf127(s2428) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Unc-32 animals. Mutagen: UV Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Helen Stewart Received: 08/31/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4649 Species: Caenorhabditis elegans Genotype: sEx67 [R151 (III) + pCes1943[rol-6(su1006)]]. Description: sEx67 [R151 (III) + pCes1943[rol-6(su1006)]]. segrgnt. 1. 20 ng/ul R151 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4650 Species: Caenorhabditis elegans Genotype: sEx68 [R13A5 (III) + pCes1943[rol-6(su1006)]]. Description: sEx68 [R13A5 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul R13A5 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4652 Species: Caenorhabditis elegans Genotype: sEx70 [T20B12 (III) + pCes1943[rol-6(su1006)]]. Description: sEx70 [T20B12 (III) + pCes1943[rol-6(su1006)]]. segrgnt 2. 20 ng/ul T20B12 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/30/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4655 Species: Caenorhabditis elegans Genotype: sEx73 [F08F8 (III) + pCes1943[rol-6(su1006)]]. Description: sEx73 [F08F8 (III) + pCes1943[rol-6(su1006)]]. segrgnt 3. 20 ng/ul F08F8 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/30/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4660 Species: Caenorhabditis elegans Genotype: sEx76 [C30C5 (III) + pCes1943[rol-6(su1006)]]. Description: sEx76 [C30C5 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul C30C5 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4662 Species: Caenorhabditis elegans Genotype: sEx77 [F56C9 (III) + pCes1943[rol-6(su1006)]]. Description: sEx77 [F56C9 (III) + pCes1943[rol-6(su1006)]]. segrgnt 1. 20 ng/ul F56C9 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/30/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4665 Species: Caenorhabditis elegans Genotype: sEx81 [F37C12 (III) + pCes1943[rol-6(su1006)]]. Description: sEx77 [F37C12 (III) + pCes1943[rol-6(su1006)]]. segrgnt 5. 20 ng/ul F37C12 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/30/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4666 Species: Caenorhabditis elegans Genotype: sEx82 [T04A6 (III) + pCes1943[rol-6(su1006)]]. Description: sEx82 [T04A6 (III) + pCes1943[rol-6(su1006)]]. segrgnt 1. 20 ng/ul T04A6 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/30/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4667 Species: Caenorhabditis elegans Genotype: sEx83 [C18H2 (III) + pCes1943[rol-6(su1006)]]. Description: sEx83 [C18H2 (III) + pCes1943[rol-6(su1006)]]. segrgnt. 1. 20 ng/ul C18H2 + 110 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4677 Species: Caenorhabditis elegans Genotype: dpy-17(e164) sDf135(s2767) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Unc-32 animals. DpyUncs arrest development at early larval stages. Mutagen: Gamma Rays Outcrossed: x Reference: CGC #2771 Gatewood BK;Bucher EA The mup-4 locus in Caenorhabditis elegans is essential for hypodermal integrity, organismal morphogenesis and embryonic body wall muscle position. Genetics 146: 165-183 1997 Made by: Helen Stewart Received: 08/31/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4694 Species: Caenorhabditis elegans Genotype: sEx95 [C14B9 (III) + pCes1943[rol-6(su1006)]]. Description: sEx95 [C14B9 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul C14B9 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/30/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4696 Species: Caenorhabditis elegans Genotype: dpy-17(e164) sDf128(s2786) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Unc-32 animals. Mutagen: Gamma Rays Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Helen Stewart Received: 08/31/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4697 Species: Caenorhabditis elegans Genotype: sDf121(s2098) unc-32(e189) III; sDp3 (III;f). Description: Unc strain. Aged: Original sDf121 strain (BC4201) was maintained on plates for approx. 2 years, and then frozen as BC4697. See also WBPaper00003827. Mutagen: Gamma Rays Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: A. Howell Received: 07/09/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4699 Species: Caenorhabditis elegans Genotype: sEx90 [D2007 (III) + pCes1943[rol-6(su1006)]]. Description: sEx90 [D2007 (III) + pCes1943[rol-6(su1006)]]. segrgnt. 5. 20 ng/ul D2007 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4700 Species: Caenorhabditis elegans Genotype: sEx91 [C29E4 (III) + pCes1943[rol-6(su1006)]]. Description: sEx91 [C29E4 (III) + pCes1943[rol-6(su1006)]]. segrgnt. 1. 20 ng/ul C29E4 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4738 Species: Caenorhabditis elegans Genotype: sEx778 [B0379 (I) + pCes1943[rol-6(su1006)]]. Description: sEx778 [B0379 (I) + pCes1943[rol-6(su1006)]]. line 1. "Low" amount of cosmid B0379 + 100 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: The Ha Received: 04/15/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4785 Species: Caenorhabditis elegans Genotype: sEx114 [C06E8 (III) + pCes1943[rol-6(su1006)]]. Description: sEx114 [C06E8 (III) + pCes1943[rol-6(su1006)]]. segrgnt. 2. 10.6 ng/ul C06E8 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/20/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4787 Species: Caenorhabditis elegans Genotype: sEx111 [F11H8 (III) + pCes1943[rol-6(su1006)]]. Description: sEx111 [F11H8 (III) + pCes1943[rol-6(su1006)]]. segrgnt 4. 20 ng/ul F11H8 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/30/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4798 Species: Caenorhabditis elegans Genotype: sEx119 [K04C2 (III) + pCes1943[rol-6(su1006)]]. Description: sEx119 [K04C2 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul K04C2 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants. Mutagen: Outcrossed: x Reference: CGC #2901 Janke DL;Schein JE;Ha T;Franz NW;O'Neil NJ;Vatcher GP;Stewart HI;Kuervers LM;Baillie DL;Rose AM Interpreting a sequenced genome: Toward a cosmid transgenic library of Caenorhabditis elegans. Genome Research 7: 974-985 1997 Made by: Diana Collins Received: 01/30/98 from Baillie D, Simon Fraser University, Vancouver, Burnaby, BC -------------------- Strain: BC4799 Species: Caenorhabditis elegans Genotype: dpy-17(e164) let-724(s2437) unc-32(e189) III; sDp3 (III;f). Description: Maintain by picking Uncs. Mutagen: EMS Outcrossed: x Reference: CGC #3304 Stewart HI;O'Neil NJ;Janke DJ;Franz NW;Chamberlin HM;Howell AM;Gilchrist EJ;Ha TT;Kuervers LM;Vatcher GP Lethal mutations defining 112 complementation groups in a 4.5 mb sequenced region of Caenorhabditis elegans chromosome III. Molecular & General Genetics 260: 280-288 1998 Made by: Howell/Stewart Rece